Additional vectors for PCR-based gene tagging inSaccharomyces cerevisiae andSchizosaccharomyces pombe using nourseothricin resistance

Driessche, Benoît Van; Tafforeau, Lionel; Hentges, Pierre; Carr, Antony; Vandenhaute, Jean

doi:10.1002/yea.1293

Cited by 97 publications

(83 citation statements)

References 31 publications

(55 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…LaG16 stands for llama antibody (nanobody) against GFP and will be referred to as αGFP. pFA6a-natMX6-PADH-3HA was purchased from Euroscarf (plasmid # P30346) [36]. pNHK53 (YIp, ADH1::OsTIR1-9Myc1) (TIR1) was obtained from the National BioResource Project, Japan (depositor: M. Kanemaki) [37].…”

Section: Methodsmentioning

confidence: 99%

The role of mitochondria in anchoring dynein to the cell cortex extends beyond clustering the anchor protein

et al. 2018

View full text Add to dashboard Cite

Organelle distribution is regulated over the course of the cell cycle to ensure that each of the cells produced at the completion of division inherits a full complement of organelles. In yeast, the protein Num1 functions in the positioning and inheritance of two essential organelles, mitochondria and the nucleus. Specifically, Num1 anchors mitochondria as well as dynein to the cell cortex, and this anchoring activity is required for proper mitochondrial distribution and dynein-mediated nuclear inheritance. The assembly of Num1 into clusters at the plasma membrane is critical for both of its anchoring functions. We have previously shown that mitochondria drive the assembly of Num1 clusters and that these mitochondria-assembled Num1 clusters serve as cortical attachment sites for dynein. Here we further examine the role for mitochondria in dynein anchoring. Using a GFP-αGFP nanobody targeting system, we synthetically clustered Num1 on eisosomes to bypass the requirement for mitochondria in Num1 cluster formation. Utilizing this system, we found that mitochondria positively impact the ability of synthetically clustered Num1 to anchor dynein and support dynein function even when mitochondria are no longer required for cluster formation. Thus, the role of mitochondria in regulating dynein function extends beyond simply concentrating Num1; mitochondria likely promote an arrangement of Num1 within a cluster that is competent for dynein anchoring. This functional dependency between mitochondrial and nuclear positioning pathways likely serves as a mechanism to order and integrate major cellular organization systems over the course of the cell cycle.

show abstract

Section: Methodsmentioning

confidence: 99%

The role of mitochondria in anchoring dynein to the cell cortex extends beyond clustering the anchor protein

et al. 2018

View full text Add to dashboard Cite

show abstract

“…To generate wild-type and mutant kar2 strains amenable to manipulation in the UPR-based genetic screen (see below), we first inserted the KAR2 or kar2-R217A coding sequence upstream of the NATMX6 antibiotic resistance cassette in the pFA6a-NATMX6 vector (31). Accordingly, the KAR2 gene containing the 3Ј-UTR (henceforth referred to as KAR2-UTR) was amplified with the following primer pair (the underlined sequence in the 5Ј primer represents the PvuII recognition site and in the 3Ј primer represents the BamHI recognition site): 5Ј primer, GTCCCCAAGAGCAGCTGCAAGGGAAA; and 3Ј primer, CAATAGTGATGGGATCCGATGAGATGA.…”

Section: Methodsmentioning

confidence: 99%

J Domain Co-chaperone Specificity Defines the Role of BiP during Protein Translocation

Vembar

Jonikas

Hendershot

et al. 2010

Journal of Biological Chemistry

View full text Add to dashboard Cite

Hsp70 chaperones can potentially interact with one of several J domain-containing Hsp40 co-chaperones to regulate distinct cellular processes. However, features within Hsp70s that determine Hsp40 specificity are undefined. To investigate this question, we introduced mutations into the ER-lumenal Hsp70, BiP/ Kar2p, and found that an R217A substitution in the J domaininteracting surface of BiP compromised the physical and functional interaction with Sec63p, an Hsp40 required for ER translocation. In contrast, interaction with Jem1p, an Hsp40 required for ER-associated degradation, was unaffected. Moreover, yeast expressing R217A BiP exhibited defects in translocation but not in ER-associated degradation. Finally, the genetic interactions of the R217A BiP mutant were found to correlate with those of known translocation mutants. Together, our results indicate that residues within the Hsp70 J domain-interacting surface help confer Hsp40 specificity, in turn influencing distinct chaperone-mediated cellular activities.Most newly synthesized proteins require the assistance of molecular chaperones to fold into their native conformations. In addition, chaperones facilitate the assembly of macromolecular structures. To perform these functions, chaperones noncovalently bind to surface-exposed hydrophobic patches, thus preventing protein aggregation and, in some cases, providing a secure folding environment (1, 2). One family of chaperones, heat shock proteins of 70 kDa (Hsp70s), 3 forms a major component of the cellular folding and stress response machinery (3, 4). Hsp70s are quite abundant and can be found in nearly every cellular compartment in eukaryotes and in most prokaryotes. Not surprisingly, they catalyze a multitude of functions, including protein folding, transport, and degradation.Hsp70s contain a conserved N-terminal ATPase domain, followed by a less conserved substrate binding domain (SBD) and a variable C-terminal "lid." The lid is flexible and helps confine the substrate within the SBD. The Hsp70 ATP hydrolytic cycle correlates with substrate binding and release, such that the ADP-bound state of Hsp70s has a higher affinity for substrates than the ATP-bound state. Because the ATPase activity of Hsp70s is weak, Hsp40 co-chaperones are needed to accelerate ATP hydrolysis and promote maximal chaperone activity (5-7). Select Hsp40 family members can also deliver substrates to Hsp70s. The interaction between Hsp70s and Hsp40s is mediated by the Hsp40 J domain, an ϳ70-amino acid motif that forms a four-helix bundle. Notably, an invariant HPD motif between helices 2 and 3 of the J domain plays a critical role in facilitating Hsp70-Hsp40 interaction.In recent years, it has become clear that Hsp40s are more diverse than Hsp70s (8). For example, Escherichia coli encode three Hsp70s and six Hsp40s, whereas the budding yeast Saccharomyces cerevisiae expresses 14 Hsp70s and 22 Hsp40s. The diversity increases in higher eukaryotes, with humans expressing 20 Hsp70s and Ͼ50 Hsp40s. Moreover, a single Hsp70 can interact with m...

show abstract

“…For GFP fusions, pFA6a-GFP(S65T)-NatMX6 was used as a PCR template (Van Driessche et al 2005). To generate dTomato fusions, we used restrictionfree (RF) cloning (van den Ent and Lowe 2006) to construct a new template vector (pFA6a-dTomato-KanMX6) by replacing the 13myc tag in pFA6a-13myc-KanMX6 (Longtine et al 1998) with the dTomato coding sequence from pFA6a-TEF2Pr-dTomato-ADH1-NATMX4 (Breslow et al 2008) (kindly provided by J. Weissman).…”

Section: Strains and Growth Conditionsmentioning

confidence: 99%

Genetic Architecture of Ethanol-Responsive Transcriptome Variation in Saccharomyces cerevisiae Strains

et al. 2014

View full text Add to dashboard Cite

Natural variation in gene expression is pervasive within and between species, and it likely explains a significant fraction of phenotypic variation between individuals. Phenotypic variation in acute systemic responses can also be leveraged to reveal physiological differences in how individuals perceive and respond to environmental perturbations. We previously found extensive variation in the transcriptomic response to acute ethanol exposure in two wild isolates and a common laboratory strain of Saccharomyces cerevisiae. Many expression differences persisted across several modules of coregulated genes, implicating trans-acting systemic differences in ethanol sensing and/or response. Here, we conducted expression QTL mapping of the ethanol response in two strain crosses to identify the genetic basis for these differences. To understand systemic differences, we focused on "hotspot" loci that affect many transcripts in trans. Candidate causal regulators contained within hotspots implicate upstream regulators as well as downstream effectors of the ethanol response. Overlap in hotspot targets revealed additive genetic effects of trans-acting loci as well as "epihotspots," in which epistatic interactions between two loci affected the same suites of downstream targets. One epi-hotspot implicated interactions between Mkt1p and proteins linked to translational regulation, prompting us to show that Mkt1p localizes to P bodies upon ethanol stress in a strain-specific manner. Our results provide a glimpse into the genetic architecture underlying natural variation in a stress response and present new details on how yeast respond to ethanol stress. N ATURAL variation in gene expression is hypothesized to be a major source of phenotypic variation between individuals (King and Wilson 1975;Oleksiak et al. 2002). Gene expression variation underlies differences in susceptibility to infectious disease (Li et al. 2010;Barreiro et al. 2012), drug sensitivity (Fay et al. 2004;Kvitek et al. 2008;Maranville et al. 2011;Hodgins-Davis et al. 2012;Chang et al. 2013), inflammation (Gargalovic et al. 2006Orozco et al. 2012), cardiovascular disease (Romanoski et al. 2010), metabolism (Fraser et al. 2010Rossouw et al. 2012;Skelly et al. 2013), morphology (Yvert et al. 2003Chin et al. 2012;Skelly et al. 2013), and even behavior (Ziebarth et al. 2012). Still, identifying the genetic and molecular mechanisms that underlie the expression variation is a major challenge.Expression quantitative trait loci (eQTL) mapping (reviewed in Gilad et al. 2008) is a powerful approach to dissect the genetic basis of expression differences. Transcript abundance is treated as a quantitative trait whose genetic determinants can be implicated by well-established linkage mapping techniques. The first eQTL studies in yeast illuminated the genetic landscape of gene expression-variation determinants under standard growth conditions (Brem et al. 2002;Yvert et al. 2003). Subsequent eQTL studies surveyed the genetic control of transcript abundance in Arabidopsi...

show abstract

Additional vectors for PCR-based gene tagging inSaccharomyces cerevisiae andSchizosaccharomyces pombe using nourseothricin resistance

Cited by 97 publications

References 31 publications

The role of mitochondria in anchoring dynein to the cell cortex extends beyond clustering the anchor protein

The role of mitochondria in anchoring dynein to the cell cortex extends beyond clustering the anchor protein

J Domain Co-chaperone Specificity Defines the Role of BiP during Protein Translocation

Genetic Architecture of Ethanol-Responsive Transcriptome Variation in Saccharomyces cerevisiae Strains

Contact Info

Product

Resources

About