Adaptation of AmtR-controlled gene expression by modulation of AmtR binding activity in Corynebacterium glutamicum

Hasselt, Kristin; Simone, Rankl; Worsch, Stefanie; Burkovski, Andreas

doi:10.1016/j.jbiotec.2010.09.930

Cited by 11 publications

(19 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, Tyr57 contacted the N7 and C8 of A +4 and the methyl group of T +5 , and rendered unfavourable the T‐to‐C substitution at the +5 position. Similar interactions of Tyr58 with T −8 and A −9 (the two bases upstream of the start of the central and most conserved part of the consensus) selected for thymine and against cytosine at the –8 position, which agrees with the more extended version of the consensus .…”

Section: Resultssupporting

confidence: 62%

“…Such contacts do not favour the replacement of these bases by C:G pairs, as these three anchor residues would clash with the amino group of the guanine in the event of any of these A:T pairs being replaced by a G:C pair. These interactions of the anchor with the bases, together with the aforementioned interactions of Tyr58 with T −8 , cooperated in conferring AmtR selectivity for AT bases at the positions preceding and following the major groove recognition sequences of the AmtR box, which are characteristic of the extended recognition sequence for AmtR .…”

Section: Resultsmentioning

confidence: 99%

“…D). Crystals were obtained from a mixture of C‐terminally His 6 ‐tagged AmtR (AmtR–His 6 ) and a self‐complementary double‐helical quasipalindromic oligonucleotide, 5′‐ATTATCTATAGATCTATAGATAATGC‐3′, which contained an idealized AmtR box (the central, stronger consensus is underlined), followed by a GC pair. In this case, the solution obtained by molecular replacement yielded two parallel DNA double helices and two AmtR dimers in the asymmetric unit (Fig.…”

Section: Resultsmentioning

confidence: 99%

See 2 more Smart Citations

Structure of AmtR, the global nitrogen regulator of Corynebacterium glutamicum, in free and DNA‐bound forms

Palanca

Rubio

2016

The FEBS Journal

View full text Add to dashboard Cite

Corynebacterium glutamicum is a bacterium used for industrial amino acid production, and understanding its metabolic pathway regulation is of high biotechnological interest. Here, we report crystal structures of AmtR, the global nitrogen regulator of C. glutamicum, in apo (2.25‐Å and 2.65‐Å resolution) and DNA‐bound (3‐Å resolution) forms. These structures reveal an all‐α homodimeric TetR family regulator composed of a helix–turn–helix‐hosting N‐terminal DNA‐binding domain and a C‐terminal dimerization domain. AmtR has several unique structural features that appear to be invariant among AmtR proteins, which may be related to its regulation by the nitrogen‐sensing trimeric protein GlnK rather than by small‐molecule effectors. As compared with other TetR family members, AmtR has an extra C‐terminal helix, a large extended external loop that resembles the flexible tranducer T‐loop of GlnK in sequence, and a large open cavity towards the intersubunit region that changes shape upon DNA binding. The marked kinking of helix 4 decreases in the DNA‐bound form. The binding of one AmtR dimer to its DNA operator involves not only the insertion of helices 3 and 3′ in adjacent turns of the double‐helix major groove, but also the anchoring of 19‐residue, arginine‐rich and proline‐rich N‐terminal extensions to two external minor grooves. Electrophoretic mobility shift assays with a deletion mutant reveal that the 19‐residue extension is crucial for AmtR binding to DNA. N‐extension anchoring explains the flanking by AT sequences of the recognized target DNA sequence core. The significance of these findings for the entire TetR family of regulators and for GlnK regulation of AmtR is discussed. Database The atomic coordinates and structure factors have been deposited in the Protein Data Bank, http://www.pdb.org [PDB ID codes http://www.rcsb.org/pdb/search/structidSearch.do?structureId=5DXZ (native AmtR), http://www.rcsb.org/pdb/search/structidSearch.do?structureId=5DY1 (SeMet–AmtR), and http://www.rcsb.org/pdb/search/structidSearch.do?structureId=5DY0 (AmtR·DNA)].

show abstract

Section: Resultssupporting

confidence: 62%

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Structure of AmtR, the global nitrogen regulator of Corynebacterium glutamicum, in free and DNA‐bound forms

Palanca

Rubio

2016

The FEBS Journal

View full text Add to dashboard Cite

show abstract

“…This relationship is very predictive of a regulatory relationship in those cases where the intergenic region between the two genes is less than ϳ200 bp. A longer intergenic region does not rule out a possible regulatory relationship; however, it is more rare [36][37][38]). In some cases, autoregulation is assumed based on other data (e.g., DNase I foot printing analysis for ActR [23]) but direct evidence is not available.…”

Section: Predicting Target Genesmentioning

confidence: 99%

The TetR Family of Regulators

Cuthbertson

Nodwell

2013

Microbiol Mol Biol Rev

467

512

View full text Add to dashboard Cite

SUMMARY The most common prokaryotic signal transduction mechanisms are the one-component systems in which a single polypeptide contains both a sensory domain and a DNA-binding domain. Among the >20 classes of one-component systems, the TetR family of regulators (TFRs) are widely associated with antibiotic resistance and the regulation of genes encoding small-molecule exporters. However, TFRs play a much broader role, controlling genes involved in metabolism, antibiotic production, quorum sensing, and many other aspects of prokaryotic physiology. There are several well-established model systems for understanding these important proteins, and structural studies have begun to unveil the mechanisms by which they bind DNA and recognize small-molecule ligands. The sequences for more than 200,000 TFRs are available in the public databases, and genomics studies are identifying their target genes. Three-dimensional structures have been solved for close to 200 TFRs. Comparison of these structures reveals a common overall architecture of nine conserved α helices. The most important open question concerning TFR biology is the nature and diversity of their ligands and how these relate to the biochemical processes under their control.

show abstract

“…The DNA sequence was copied from the maxima score value in an experimental procedure with the AmtR binding sequence of 17 gene/operon and from the AmtR binding consensus motif represented by the highly conserved positions in the region CTET (see: Beckers et al, (2005);Burkovski (2007); and Hasselt, Rankl, Worsch, & Burkovski (2011), for more details).…”

Section: ) Dna Modellingmentioning

confidence: 99%

Caracterización de la proteína transductora de señal AmtR

2013

Self Cite

View full text Add to dashboard Cite

Each year, two million tons of amino acids are produced, most of them by application of Corynebacterium glutamicum in bioprocesses. Nowadays the amino acids industry is developing methods to increase the production yield. This development has integrated understanding of the elaborated mechanisms to provide an optimal nitrogen supply for metabolism and to overcome and survive situations of nitrogen limitation (Muhl, 2009;Hasselt, Sevvana, Burkovski, & Muller, 2009;Beckers et al., 2005). In this way the master regulator of nitrogen control called AmtR is responsible to block transcription of various genes when nitrogen is present in surplus. This work analyses the fascinating repression complex, in the sophisticated network of interaction that correspond to the relation of AmtR with the DNA in a homology model in 100 ns of molecular dynamics. Where the results revealed six amino acids located in a correct position in the binding zone that they permit to interact strongly with the DNA and the spectacular role of amino acid tyrosine in the protein binding.

show abstract

Adaptation of AmtR-controlled gene expression by modulation of AmtR binding activity in Corynebacterium glutamicum

Cited by 11 publications

References 38 publications

Structure of AmtR, the global nitrogen regulator of Corynebacterium glutamicum, in free and DNA‐bound forms

Structure of AmtR, the global nitrogen regulator of Corynebacterium glutamicum, in free and DNA‐bound forms

The TetR Family of Regulators

Caracterización de la proteína transductora de señal AmtR

Contact Info

Product

Resources

About