Acylated Ghrelin Attenuates l-Thyroxin–induced Cardiac Damage in Rats by Antioxidant and Anti-inflammatory Effects and Downregulating Components of the Cardiac Renin–angiotensin System

Abstract

This study investigated the protective effect of acylated ghrelin (AG) against L-thyroxin (L-Thy)-induced cardiac damage in rats and examined possible mechanisms. Male rats were divided into five intervention groups of 12 rats/group: control, control + AG, L-Thy, L-Thy + AG, and L-Thy + AG + [D-Lys3]-GHRP-6 (AG antagonist). L-Thy significantly reduced the levels of AG and desacyl ghrelin and the AG to des-acyl ghrelin ratio. Administration of AG to L-Thy-treated rats reduced cardiac weights and levels of reactive oxygen species and preserved the function and structure of the left ventricle. In addition, AG also reduced the protein levels of cleaved caspase-3 and cytochrome c and prevented mitochondrial permeability transition pore opening. In the left ventricle of both control + AG-treated and L-Thy + AG-treated rats, AG significantly increased left ventricular levels of manganese superoxide dismutase (SOD2), total glutathione (GSH), and Bcl2. It also reduced the levels of malondialdehyde, tumor necrosis factor-a (TNF-a), interleukin-6, and Bax and the nuclear activity of nuclear factor-kappa B. Concomitantly, in both treated groups, AG reduced the mRNA and protein levels of NADPH oxidase 1, angiotensin (Ang) II type 1 receptor, and Ang-converting enzyme 2. All the beneficial effects of AG in L-Thy-treated rats were prevented by the coadministration of [D-Lys3]-GHRP-6, a selective growth hormone secretagogue receptor subtype 1a antagonist. In conclusion, AG protects against hyperthyroidism-induced cardiac hypertrophy and damage, which is mainly due to its antioxidant and anti-inflammatory potentials and requires the activation of GHS-R1a.

N-Terminal Pro-Brain Natriuretic Peptide Correlates with Ghrelin and Acyl-Ghrelin in Pre-Dialysis Chronic Kidney Disease

“…This lack of specificity may be a cause of conflicting data. It appears that the acetylated form is required for ghrelin activity [ 45 ]. According to a recent review by Hosoda, there are multiple molecules derived from ghrelin, each with a different number of fatty acids.…”

“…Regarding acyl-ghrelin, it is known that it has a cardiovascular protective effect due to its antioxidant and anti-inflammatory properties [ 45 ]. In our study, we observed that it was linked to inflammatory mediators such as IL-1 beta, but not to classic ones such as high-sensitivity C-reactive protein (hs-CRP).…”

High triiodothyronine levels induce myocardial hypertrophy via BAFF overexpression

“…The real‐time PCR efficiency of β‐actin and GAPDH was similar, and expression of the two reference genes was constant. We selected β‐actin as reference gene and expression of the target gene was normalized to β‐actin as previous studies 19 . The (5′→3′) forward and reverse primers were as follows: mouse BAFF, CCACCGTGCCTCTGTTTTTG and CTTCTGCGGAGTGATGGGAT; mouse TNF‐α, GATGGGGGGCTTCCAGAACT and TGGGGACCGATCACCCCGAA; mouse β‐actin, AGAGGGAAATCGTGCGTGAC and CAATAGTGATGACCTGGCCGT.…”