Acute Intermittent Porphyria: A Diagnostic Challenge

Vakili, Rahim; Armanpoor, Parisa

doi:10.5812/ijp.5238

Cited by 6 publications

(6 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Patients in acute attacks typically present 3 dominated clinical manifestations (acute abdominal pain, peripheralor spinal neuropathy, and psychiatric disorders), resulted from the redundancy of the porphyrin precursors. A total of 95% patients with acute onset have severe but poorly localized abdominal pain and may be wrongly diagnosed as “acute abdomen,” such as appendicitis, cholecystitis, etc., [ 5 , 9 ] as is in our case. The patient's first chief complaint was acute abdominal pain with other typical symptoms including nausea, vomiting, constipation or diarrhea, tachycardia, and hypertension.…”

Section: Discussionsupporting

confidence: 73%

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family

Ren

Liu

et al. 2018

Medicine

View full text Add to dashboard Cite

Rationale:Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation.Patient concerns:A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia.Diagnoses:She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome.Interventions:The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing.Outcomes:A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability.Lessons:Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

show abstract

Section: Discussionsupporting

confidence: 73%

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family

Ren

Liu

et al. 2018

Medicine

View full text Add to dashboard Cite

show abstract

“…2 Intriguingly in AHP, symptoms of the disease in the same patient during different episodes and in different patients with the same porphyria subtype are different. 3 Our patient, a young woman, presented with nonspecific abdominal pain and generalised weakness in limbs. Moreover, her βhuman chorionic gonadotropin was elevated indicative of pregnancy, thereby welcoming many obstetric differential diagnoses for her presentation like ruptured ectopic gestation, early pregnancy loss or molar pregnancy, apart from the regular causes for acute abdomen.…”

Section: Descriptionmentioning

confidence: 86%

Pink urine as an inkling for a diagnostic dilemma: acute hepatic porphyria

2021

View full text Add to dashboard Cite

“…The type of porphyria and the associated clinical manifestations depend on several biosynthesis step blocks, leading to the aggregation of porphyrin or its precursors [deltaaminolevulinic acid (ALA) and porphobilinogen (PBG)] and causing characteristic clinical features: acute neurovisceral attacks, skin lesions, or both. Clinical signs can appear in childhood, although they usually appear in adults [79]. Acute psychiatric breaks are distinctively associated with acute intermittent porphyria (AIP) or hereditary coproporphyria (HC).…”

Section: Porphyriasmentioning

confidence: 99%

Psychiatric Manifestations in Children and Adolescents with Inherited Metabolic Diseases

Baglioni,

Bozza,

Lentini

et al. 2024

JCM

View full text Add to dashboard Cite

Background: Inherited metabolic disorders (IEMs) can be represented in children and adolescents by psychiatric disorders. The early diagnosis of IEMs is crucial for clinical outcome and treatment. The aim of this review is to analyze the most recurrent and specific psychiatric features related to IEMs in pediatrics, based on the onset type and psychiatric phenotypes. Methods: Following the PRISMA Statement, a systematic literature review was performed using a predefined algorithm to find suitable publications in scientific databases of interest. After removing duplicates and screening titles and abstracts, suitable papers were analyzed and screened for inclusion and exclusion criteria. Finally, the data of interest were retrieved from the remaining articles. Results: The results of this study are reported by type of symptoms onset (acute and chronic) and by possible psychiatric features related to IEMs. Psychiatric phenomenology has been grouped into five main clinical manifestations: mood and anxiety disorders; schizophrenia-spectrum disorders; catatonia; eating disorders; and self-injurious behaviors. Conclusions: The inclusion of a variety of psychiatric manifestations in children and adolescents with different IEMs is a key strength of this study, which allowed us to explore the facets of seemingly different disorders in depth, avoiding possible misdiagnoses, with the related delay of early and appropriate treatments.

show abstract

Acute Intermittent Porphyria: A Diagnostic Challenge

Cited by 6 publications

References 5 publications

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family

Pink urine as an inkling for a diagnostic dilemma: acute hepatic porphyria

Psychiatric Manifestations in Children and Adolescents with Inherited Metabolic Diseases

Contact Info

Product

Resources

About