Activin/follistatin system in grass carp pituitary cells: - Regulation by local release of growth hormone and luteinizing hormone and its functional role in growth hormone synthesis and secretion

Abstract

Gonadotrophin regulation by activin/follistatin system is well-documented, but the corresponding effect on growth hormone (GH) has not been fully characterized and with little information available in lower vertebrates, especially in fish models. In grass carp, local interactions of GH and luteinizing hormone (LH) can induce GH release and gene expression at pituitary level via autocrine/paracrine mechanisms. To shed light on the role of activin/follistatin system in GH regulation by local actions of GH and LH, grass carp activin βA and βB were cloned, shown to be single-copy genes expressed in the pituitary, and confirmed to encode activin proteins capable of transactivating promoter with activin-responsive elements. In grass carp pituitary cells, activin A and B were effective in reducing GH secretion and GH cell content with concurrent drop in GH mRNA level whereas the opposite was true for follistatin, the activin-binding protein known to neutralize the effects of endogenous activin. Treatment with activin A and B not only could suppress basal but also inhibit GH mRNA expression induced by GH and human chorionic gonadotropin (hCG), a functional analogue of LH in fish model. Apparently, down-regulation of GH mRNA by activin was mediated by reducing GH transcript stability with concurrent inhibition on GH promoter activity via the SMAD pathway. In reciprocal experiments, GH treatment was found to up-regulate activin βA, activin βB and follistatin mRNA levels in carp pituitary cells but the opposite was noted by removing endogenous GH with GH antiserum. Interestingly, parallel treatment with hCG could also inhibit basal as well as GH-induced activin βA, activin βB and follistatin gene expression. These results, as a whole, indicate that the pituitary activin/follistatin system can serve as a regulatory target for local interactions of GH and LH and contribute to GH regulation by autocrine/paracrine mechanisms in the carp pituitary.

Grass Carp Follisatin: Molecular Cloning, Functional Characterization, Dopamine D1 Regulation at Pituitary Level, and Implication in Growth Hormone Regulation

“…For real-time PCR of follistatin, gene-specific primers for carp follistatin (5′ATGCAAAGGGCACCCGGATCT3′ and 5′ATCGCATGACTTGGCCTTGATG3′, producing a 292 bp PCR product with Tm value at 92 o C) were used for quantitative PCR with serial dilutions of plasmid DNA carrying the ORF of follistatin as the standards for data calibration. PCR reactions were conducted with denaturation at 95 o C for 30 s, annealing at 56 o C for 30 s, and extension at 72 o C for 30 s for a total of 32 cycles and PCR signals for follistation expression were recorded by the end of individual cycles with acquiring temperature at 88 o C. For the measurement of activin βA, activin βB, and GH mRNA expression, real-time PCR for the respective gene targets was conducted as described previously ( 42 ). In our studies, the authenticity of PCR products was routinely monitored by melting curve analysis after the real-time PCR assays and parallel measurement of 18S RNA expression was used as the internal control.…”

“…At somatotroph level, the stimulatory effects on GH expression can be further amplified by GH autoregulation via GH-induced GH release and GH gene expression mediated by JAK 2 /MAPK and JAK 2 /PI3K cascades ( 41 ) and GH released locally in turn can trigger signal termination via paracrine inhibition of LH secretion from nearby goanadotrophs ( 39 ). In our recent study, activin was also found to interact with GH and LH released locally at pituitary level to modulate GH secretion and gene expression in grass carp ( 42 ). In this case, the two forms of activin β subunits, activin βA and βB, were shown to be up-regulated by GH treatment in carp pituitary cells via JAK 2 /STAT 5 , MAPK, and PI3K/Akt pathways and local production of activin A and B in turn could suppress GH release, GH production, and GH gene expression with concurrent drop in GH gene transcription via SMAD 2 /SMAD 3 -dependent mechanisms ( 42 ).…”

“…In our recent study, activin was also found to interact with GH and LH released locally at pituitary level to modulate GH secretion and gene expression in grass carp ( 42 ). In this case, the two forms of activin β subunits, activin βA and βB, were shown to be up-regulated by GH treatment in carp pituitary cells via JAK 2 /STAT 5 , MAPK, and PI3K/Akt pathways and local production of activin A and B in turn could suppress GH release, GH production, and GH gene expression with concurrent drop in GH gene transcription via SMAD 2 /SMAD 3 -dependent mechanisms ( 42 ). In the same study, both basal as well as GH-induced activin βA and βB gene expression were also suppressed by LH released locally in carp pituitary cells, suggesting that activin may constitute as a new facet of the intrapituitary feedback loop for GH regulation.…”

Differential expression of activin βA and βB genes in female allotriploid and diploid red crucian carp Carassius auratus red var

“…Fung et al . () reported that activin has an effect on GH in grass carp Ctenopharyngodon idella (Valenciennes 1844) (Fung et al ., ). Hence, the differential expression of activin β A and activin β B mRNA in the pituitaries showed that activin in the pituitaries of diploid and AC carp might have multiple functions in addition to regulating reproduction.…”

Elevated Expression of follistatin Gene in the Pituitaries of Allotriploid Crucian Carp

“…In eel, Aroua et al () have elaborated that recombinant human follistatin, respectively, antagonized both the stimulatory and inhibitory effects of activin on FSHβ and LHβ expression using primary cultures of eel pituitary cells. More recently in grass carp, Fung et al () elucidated that LH but not FSH could suppress activin and follistatin messenger RNA (mRNA) expression in grass carp pituitary cells in a time‐ and dose‐dependent manner.…”