Activation of Vascular Endothelial Growth Factor Gene Transcription by Hypoxia-Inducible Factor 1

Abstract

Expression of vascular endothelial growth factor (VEGF) is induced in cells exposedUnder normal physiologic conditions, each of the approximately 10 14 cells in the adult human body is provided with an adequate supply of O 2 to meet its metabolic demands through the concerted function of the pulmonary, hematopoietic, and cardiovascular systems. O 2 is transported through the circulation by erythrocytes, the production of which is controlled by the glycoprotein hormone/growth factor erythropoietin (EPO) (reviewed in references 20, 23, and 43). Cells in the liver and kidney that produce EPO are able to sense O 2 concentration and respond to systemic hypoxia with increased EPO gene transcription (8,15,46). A hypoxia-inducible enhancer element was identified in the 3Ј-flanking region of the human and mouse EPO genes (2,3,33,42,48,50). Hypoxia-inducible factor 1 (HIF-1) was detected in nuclear extracts of hypoxic Hep3B cells (exposed to 1% O 2 for 4 h) and was undetectable in extracts from nonhypoxic cells (maintained at 20% O 2 ). HIF-1 bound to the EPO enhancer, and mutations that eliminated HIF-1 binding also eliminated enhancer function (50). Exposure of hypoxic cells to inhibitors of protein synthesis (cycloheximide) or phosphorylation (2-aminopurine) inhibited the induction of both EPO mRNA and HIF-1 DNA-binding activity, and other inducers of EPO expression (CoCl 2 and desferrioxamine) also induced HIF-1 activity (50,58,60). Methylation interference analysis revealed that HIF-1 bound to the EPO enhancer sequence 5Ј-TACGTGCT-3Ј by making major groove contacts with both guanine residues on each strand (59).Protein purification indicated that HIF-1 was a heterodimeric protein (61). Peptide and nucleic acid sequence analysis demonstrated that both subunits were basic helixloop-helix (bHLH) proteins (57). HIF-1␣ was a novel 826-amino-acid polypeptide, whereas HIF-1␤ was identical to the 774-and 789-amino-acid products of the ARNT (aryl hydrocarbon receptor nuclear translocator) gene previously shown to heterodimerize with the aryl hydrocarbon receptor (AHR) (57). HIF-1␣, HIF-1␤ (ARNT), and AHR are all members of a subfamily of bHLH proteins that contain a conserved PAS domain following the bHLH motif (4,18,57). In all three polypeptides, the basic domain is required for DNA binding following heterodimerization mediated by the HLH and PAS domains, and the C terminus contains one or more transactivation domains (6,21,29,32,44,63). Forced expression of HIF-1␣ and HIF-1␤ (ARNT) in cultured cells transfected with a reporter plasmid containing the EPO enhancer resulted in significantly higher levels of transcription, both at 1% and at 20% O 2 , than in cells transfected with the reporter plasmid alone, demonstrating that transcriptional activation via the EPO enhancer is mediated by HIF-1 (21).In contrast to systemic hypoxia, which elicits increased EPO synthesis, hypoxia can also be restricted to cells within a localized region of a specific organ, usually as a result of insufficient perfusion, as in the case of myocard...

Assessment of the gene expression profile of differentiated and dedifferentiated human fetal chondrocytes by microarray analysis

“…In order to address this hypothesis, we performed an EMSA to detect binding of HIF-1, which is a dimer of HIF-1␣ and HIF-1␤ (also known as aryl hydrocarbon receptor nuclear translocator [ARNT]). For this experiment, we used a 20-bp probe containing either a wild-type or mutated version of a HIF-1 binding site from the human VEGF gene (43). As can be seen in Figure 4B, we detected the formation of a slowly migrating complex (see arrow) only with the wild-type probe, consistent with previous results concerning binding by HIF-1 (43).…”

“…The probes consisted of wild-type and mutated HIF-1 binding sites from the promoter region of the human VEGF gene (wild type ACAGTGCATACGTGGGCTCCAAC; mutated ACAGTGCACGATGTGGCTCCAAC) (differences in sequences are in boldface type) (43). Binding reaction mixtures were incubated for 50 minutes at 4°C and then loaded onto 4% acrylamide/0.25ϫ Tris-borate-EDTA gels and electrophoresed at 200V for 1.5 hours.…”

Conditional activation of FGFR1 in the prostate epithelium induces angiogenesis with concomitant differential regulation of Ang-1 and Ang-2

“…Therefore, we sought to identify molecular signaling pathways differentially regulated in response to iFGFR1 activation in the epithelium that could mediate this response in vivo. As iFGFR1 activation is known to induce rapid epithelial proliferation (Freeman et al, 2003), we first examined whether the hyperplastic phenotype would cause localized hypoxia and thereby result in a stabilization of HIF-1a (Wang and Semenza, 1995) with concomitant upregulation of VEGF signaling (Forsythe et al, 1996). Here we chose to analyse prostate protein extracts from JOCK-1 mice treated with CID for 2 weeks because quantitative measurements of vasculature in the various cohorts suggested that angiogenesis was proceeding in a linear fashion between 2 and 4 weeks of enforced JOCK-1 mice were given AP20187 (CID) for 1, 2, 4 or 6 weeks.…”

The role of oxygen availability in embryonic development and stem cell function

“…During mammalian vascular development (see Figure 1B), vascular endothelial growth factor (VEGF) is a dominant angiogenic growth factor produced by O 2 -starved cells 13,14 . Like FGF, VEGF is used reiteratively during several steps of vertebrate vascular morphogenesis (as shown in Figure 1B), including vasculogenesis and angiogenesis 15 ,16 .…”