Activation of endocrine-related gene expression in placental choriocarcinoma cell lines following DNA methylation knock-down

Abstract

Increasingly, placental DNA methylation is assessed as a factor in pregnancy-related complications, yet the transcriptional impact of such findings is not always clear. Using a proliferative in vitro placental model, the effect of DNA methylation loss on gene activation was evaluated at a number of genes selected for being differentially methylated in pre-eclampsia-associated placentae in vivo. We aimed to determine whether reduced DNA methylation at specific loci was associated with transcriptional changes at the corresponding gene, thus providing mechanistic underpinnings for previous clinical findings and to assess the degree of transcriptional response amongst our candidate genes. BeWo and JEG3 choriocarcinoma cells were exposed to 1 mM 5-Aza-2 ′ -deoxycytidine (5-Aza-CdR) or vehicle control for 48 h, and re-plated and cultured for a further 72 h in normal media before cells were harvested for RNA and DNA. Bisulphite pyrosequencing confirmed that DNA methylation was reduced by 30 -50% points at the selected loci studied in both cell lines. Gene activation, measured by qRT-PCR, was highly variable and transcript specific, indicating differential sensitivity to DNA methylation. Most notably, loss of DNA methylation at the leptin (LEP) promoter corresponded to a 200-fold and 40-fold increase in LEP expression in BeWo and JEG3 cells, respectively (P , 0.01). Transcripts of steroidogenic pathway enzymes CYP11A1 and HSD3B1 were up-regulated 40-fold in response to 5-Aza-CdR exposure in BeWo cells (P , 0.01). Other transcripts, including aromatase (CYP19), HSD11B2, inhibin (INHBA) and glucocorticoid receptor (NR3C1) were more moderately, although significantly, affected by loss of associated DNA methylation. These data present a mixed effect of DNA methylation changes at selected loci supporting cautionary interpretation of DNA methylation results in the absence of functional data.

The role of estrogens in the adipose tissue milieu

“…Human CYP19A1 has at least eight different transcriptional start sites encoding unique upstream exons, each of which is specific to a different tissue. Using this method, DNA methylation was found to regulate aromatase expression in primary APs, 75 breast adipose fibroblasts, 76 skin fibroblasts, 77 endometrial stromal cells, 78 placental choriocarcinoma, 79 placenta, 80 and neuroglia. 71,72 A large body of work demonstrates that epigenetic regulation of these promoters is important in modulating the expression of aromatase.…”

“…DNA methylation-the addition of a methyl group to the 5-position of cytosine-is a well-studied epigenetic mechanism, 73 and can be modulated by treatment of cells with the DNA methylation inhibitors 5-azacytidine or 2-deoxy-5-azacytidine 74 to test whether a gene is under epigenetic control. Using this method, DNA methylation was found to regulate aromatase expression in primary APs, 75 breast adipose fibroblasts, 76 skin fibroblasts, 77 endometrial stromal cells, 78 placental choriocarcinoma, 79 placenta, 80 and neuroglia. 81 Epigenetic regulation of aromatase by DNA methylation appears widely conserved across evolution, including in chicken, 82 rat, 83 alligator, 84 sea bass, 85 zebrafish, 86 perch, 87 eel, 88 buffalo, 89,90 sheep, and cattle.…”

The Human Placental Methylome

“…For example, methylation and down-regulation of OCT4 is associated with normal trophoblast differentiation early in development (Zhang et al 2008) and methylation of tumor suppressor genes, such as RASSF1 or APC, is associated with trophoblast invasiveness (Novakovic et al 2008). Further evidence for the importance of DNA methylation for gene expression in placental trophoblast comes from in vitro studies using 5-Aza-2 0 -deoxycytidine to inhibit DNA methylation in choriocarcinoma cells (Hogg et al 2014b). …”

Sperm Ribosomal DNA Promoter Methylation Levels Are Correlated With Paternal Aging and May Relate With in vitro Fertilization Outcomes

“…PCR products were then pyrosequenced using a PyroMark Q96 ID System (Qiagen, United States). PCR primers used to detect LINE-1 methylation level as described previously (Braiteh et al, 2008;Hogg et al, 2014) were: Forward, TTTTGAGTTAGGTGTGGGATATA; Reverse, Bio-AAAATCAAAAAATTCCCTTTC; sequencing primer, AGTTAGGTGTGGGATATAGT. Primer sequences and sequences of rDNA promoter regions whose methylation levels were analyzed are presented in Table 1 and Supplementary Figure S1.…”