Acetylcholinesterase of the sand fly, Phlebotomus papatasi (Scopoli): cDNA sequence, baculovirus expression, and biochemical properties

Abstract

BackgroundMillions of people and domestic animals around the world are affected by leishmaniasis, a disease caused by various species of flagellated protozoans in the genus Leishmania that are transmitted by several sand fly species. Insecticides are widely used for sand fly population control to try to reduce or interrupt Leishmania transmission. Zoonotic cutaneous leishmaniasis caused by L. major is vectored mainly by Phlebotomus papatasi (Scopoli) in Asia and Africa. Organophosphates comprise a class of insecticides used for sand fly control, which act through the inhibition of acetylcholinesterase (AChE) in the central nervous system. Point mutations producing an altered, insensitive AChE are a major mechanism of organophosphate resistance in insects and preliminary evidence for organophosphate-insensitive AChE has been reported in sand flies. This report describes the identification of complementary DNA for an AChE in P. papatasi and the biochemical characterization of recombinant P. papatasi AChE.MethodsA P. papatasi Israeli strain laboratory colony was utilized to prepare total RNA utilized as template for RT-PCR amplification and sequencing of cDNA encoding acetylcholinesterase 1 using gene specific primers and 3’-5’-RACE. The cDNA was cloned into pBlueBac4.5/V5-His TOPO, and expressed by baculovirus in Sf21 insect cells in serum-free medium. Recombinant P. papatasi acetylcholinesterase was biochemically characterized using a modified Ellman’s assay in microplates.ResultsA 2309 nucleotide sequence of PpAChE1 cDNA [GenBank: JQ922267] of P. papatasi from a laboratory colony susceptible to insecticides is reported with 73-83% nucleotide identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85% amino acid identity with acetylcholinesterases of Cx. pipiens, Aedes aegypti, and 92% amino acid identity for L. longipalpis. Recombinant P. papatasi AChE1 was expressed in the baculovirus system and characterized as an insect acetylcholinesterase with substrate preference for acetylthiocholine and inhibition at high substrate concentration. Enzyme activity was strongly inhibited by eserine, BW284c51, malaoxon, and paraoxon, and was insensitive to the butyrylcholinesterase inhibitors ethopropazine and iso-OMPA.ConclusionsResults presented here enable the screening and identification of PpAChE mutations resulting in the genotype for insensitive PpAChE. Use of the recombinant P. papatasi AChE1 will facilitate rapid in vitro screening to identify novel PpAChE inhibitors, and comparative studies on biochemical kinetics of inhibition.

Surface Display of Recombinant Drosophila melanogaster Acetylcholinesterase for Detection of Organic Phosphorus and Carbamate Pesticides

“…Firstly, our recombinant enzyme showed more sensitivity to carbaryl and carbofuran than natural AChE purified from different species including Oncorhynchus tshawytscha , Clarias batrachus , Electrophorus electricus and Bos Taurus [31], [32]. Secondly, compared to recombinant enzymes such as Schizaphis graminum AChE and P. papatasi AChE produced in different baculovirus-based insect cells expression systems, our yeast-expressed AChE could be more effectively inhibited by paraoxon and/or carbaryl [33], [34]. Even if the yeast-based recombinant D. melanogaster AChE expression system was also used, our surface display system showed more advantages and got better effects on monocrotophos and omethoate [30], [35], [36].…”

Inhibitor profile of bis(n)-tacrines and N-methylcarbamates on acetylcholinesterase from Rhipicephalus (Boophilus) microplus and Phlebotomus papatasi

“…microplus Bm AChE1 (Table 1) were produced as previously described [33], except that baculovirus supernatants containing rBmAChE1 were produced in sf21 insect cell culture grown in Gibco ® Sf-900 ™ III SFM (serum-free medium, Life Technologies, Carlsbad, CA). Site-directed mutagenesis was utilized to convert the codon for W384 to F384 (W384F) in cDNA of BmAChE1 (Deutch #5, wt) pre-cloned into the baculoviral transfer plasmid pBlueBac4.5/B5-His-TOPO ® (Life Technologies) as previously described [35]. Briefly, 5′-phosphorylated PCR primers Bm AChE1-1203U29X (CTTCTTCTTGCAATACTTCTTCGGATTTC) and Bm AChE1-1181L22 (GAACCTTCGTTTGCGTTAGAAC) were utilized (25 cycles, 66°C annealing temp, 4 min extension at 72°C) with the Phusion ® Site-Directed Mutagenesis Kit (Thermo Fisher Scientific, Pittsburg, PA) to perform targeted mutagenesis following the instructions of the manufacturer.…”

“…Briefly, 5′-phosphorylated PCR primers Bm AChE1-1203U29X (CTTCTTCTTGCAATACTTCTTCGGATTTC) and Bm AChE1-1181L22 (GAACCTTCGTTTGCGTTAGAAC) were utilized (25 cycles, 66°C annealing temp, 4 min extension at 72°C) with the Phusion ® Site-Directed Mutagenesis Kit (Thermo Fisher Scientific, Pittsburg, PA) to perform targeted mutagenesis following the instructions of the manufacturer. The mutagenized plasmid was transformed into E. coli TOP10 chemically competent cells, sequence verified, and co-transfected with Bac-N-Blue ™ DNA into Sf21 insect cells as previously described [35]. Baculovirus cultures were produced in sf21 cells grown in Gibco Sf-900 ™ III SFM.…”

Acetylcholinesterases of blood-feeding flies and ticks

“…Mutations generating altered AChE insensitive to OP inhibition have been well documented in flies and mosquitoes [37]. We have identified cDNAs encoding AChEs and biochemically characterized the recombinant enzymes produced in the baculovirus system for wild type (OP-susceptible) stable fly, Stomoxys calcitrans [38], wild type and OP-resistant horn fly, Haematobia irritans [39][40][41], and the wild type sand fly, Phlebotomus papatasi [ [42], unpublished].…”