Acetyl-11-Keto-β-Boswellic Acid (AKBA) Prevents Lipopolysaccharide-Induced Inflammation and Cytotoxicity on H9C2 Cells

Taherzadeh, Danial; Rahimi, Vafa Baradaran; Amiri, Hamed; Ehtiati, Sajjad; Yahyazadeh, Roghayeh; Hashemy, Seyed Isaac; Askari, Vahid Reza

doi:10.1155/2022/2620710

Cited by 14 publications

(8 citation statements)

References 61 publications

(117 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…H9c2 rat cardiomyoblast cells were utilized to investigate the protective effects of carnosol (5, 10, and 20 μ M) against inflammation resulting through LPS for 24 h, then followed cotreatment with LPS (10 μ g/mL) stimulation [ 23 ]. H9c2 cells were routinely cultured in RPMI-1640 supplemented with 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin, which was incubated with 5% v/v CO 2 at 37°C.…”

Section: Methodsmentioning

confidence: 99%

“…After the cell treatment in the first and second experiments (at a density of 2 × 10 6 cell/well), the supernatant of cells was gathered to measure the secretory levels of inflammatory mediators TNF- α , IL-1 β , IL-6, and PGE 2 , according to the manufacturer's protocol with the help of the corresponding ELISA kits [ 23 , 24 ].…”

Section: Methodsmentioning

confidence: 99%

“…At the next step, 2 μ g of purified RNA was also reversely transcripted to cDNA by cDNA synthesis kit based on the manufacturers' guidelines. Then, the real-time PCR was carried out using the SYBR Green master mix, which was described in our previous reports using the 2 −ΔΔCt , where Ct represents the threshold cycle number [ 23 , 24 ]. The primers' sequences (from 5′ to 3′) [ 23 – 25 ] were as follows: TNF- α , forward: AAATGGGCTCCCTCTCATCAGTTC and reverse: TCTGCTTGGTGGTTTGCTACGAC; COX-2, forward: TGTATGCTACCATCTGGCTTCGG and reverse: GTTTGGAACAGTCGCTCGTCATC; IL-1 β , forward: CACCTCTCAAGCAGAGCACAG and reverse: GGGTTCCATGGTGAAGTCAAC; IL-6, forward: TCCTACCCCAACTTCCAATGCTC and reverse: TTGGATGGTCTTGGTCCTTAGCC; and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), forward: GTATTGGGCGCCTGGTCACC and reverse: CGCTCCTGGAAGATGGTGATGG.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Carnosol Attenuates LPS-Induced Inflammation of Cardiomyoblasts by Inhibiting NF-κB: A Mechanistic in Vitro and in Silico Study

Rahimi

Momeni-Moghaddam

Chini

et al. 2022

Evidence-Based Complementary and Alternative Medicine

Self Cite

View full text Add to dashboard Cite

Carnosol possesses several beneficial pharmacological properties. However, its role in lipopolysaccharide (LPS) induced inflammation and cardiomyocyte cell line (H9C2) has never been investigated. Therefore, the effect of carnosol and an NF-κB inhibitor BAY 11-7082 was examined, and the underlying role of the NF-κB-dependent inflammatory pathway was analyzed as the target enzyme. Cell viability, inflammatory cytokines levels (tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, and prostaglandin E2 (PGE2)), and related gene expression (TNF-α, IL-1β, IL-6, and cyclooxygenase-2 (COX-2)) were analyzed by ELISA and real-time PCR. In addition, docking studies analyzed carnosol’s molecular interactions and binding modes to NF-κB and IKK. We report that LPS caused the reduction of cell viability while enhancing both cytokines protein and mRNA levels ( P < 0.001 , for all cases). However, the BAY 11-7082 pretreatment of the cells and carnosol increased cell viability and reduced cytokine protein and mRNA levels ( P < 0.001 vs. LPS, for all cases). Furthermore, our in silico analyses also supported the modulation of NF-κB and IKK by carnosol. This evidence highlights the defensive effects of carnosol against sepsis-induced myocardial dysfunction and, contextually, paved the rationale for the next in vitro and in vivo studies aimed to precisely describe its mechanism(s) of action.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Carnosol Attenuates LPS-Induced Inflammation of Cardiomyoblasts by Inhibiting NF-κB: A Mechanistic in Vitro and in Silico Study

Rahimi

Momeni-Moghaddam

Chini

et al. 2022

Evidence-Based Complementary and Alternative Medicine

Self Cite

View full text Add to dashboard Cite

show abstract

“…More recently, according to in vitro LPS-induced inflammation on H9C2 cells, an in vivo zebrafish larval model and molecular docking study, Boswellia extract and BAs inhibited inflammation and cytotoxicity and showed strong redox activity. The mechanism of action may be by increasing anti-inflammatory activity by decreasing specific inflammatory gene expression (iNOS, TNF-α, IL-1, and COX-2) (Siddhu et al 2022 ; Taherzadeh et al 2022 ). Taken together, the results of the above studies show evidence that GA and BA suppress SARS-CoV-2-induced inflammation through inhibition of the NLRP3 inflammasome pathway and HMGB1 release.…”

Section: Resultsmentioning

confidence: 99%

Glycyrrhizin and boswellic acids, the golden nutraceuticals: multitargeting for treatment of mild–moderate COVID-19 and prevention of post-COVID cognitive impairment

2022

View full text Add to dashboard Cite

Breakthrough infections have been reported in fully vaccinated persons. Furthermore, rebound symptoms have been reported following the new FDA granted emergency use to combat SARS-CoV-2. Glycyrrhizin (GR) and boswellic acids (BAs) combination has been shown to have highly successful actions against COVID-19 in our recent clinical trial. However, the study is limited by the small sample size, and therefore, the aim of this article is to comprehensively evaluate recent evidence on the efficacy of GR and BAs in preventing the development of COVID-19 in patients with mild and moderate infections and in preventing post-COVID-19 cognitive impairment, which is the most important symptom after recovery from Covid-19 disease. We have reviewed and discussed information published since the outbreak of the COVID-19 pandemic until July 2022 on preclinical (in vivo, in vivo and bioinformatics) and clinical studies related to the antiviral, anti-inflammatory and immunomodulatory activity of Gr and BAs. Sixteen studies were performed to determine the efficacy of GR against SARS-CoV-2. Ten studies were used primarily for in vitro and in vivo assays and six used molecular docking studies. However, the antiviral activity of BAs against SARS-CoV-2 was determined in only five studies using molecular modeling and bioinformatics. All these studies confirmed that GR n and BAs have strong antiviral activity and can be used as a therapeutic agent for COVID-19 and as a protective agent against SARS-CoV-2. They may act by inhibiting the main protease SARS-CoV-2 (Mpro) responsible for replication and blocking spike protein-mediated cell entry. Only seven rigorously designed clinical trials regarding the usefulness of GR, BAs or their combinations in the treatment of COVID-19 have been published as of July 2022. Although there is no clinical study regarding the treatment of cognitive impairment after COVID-19 that has been published so far, several preclinical and clinical studies have demonstrated the potential effect of GR and BAs in the prevention and treatment of cognitive impairment by inhibiting the activity of several molecules that activate inflammatory signaling pathway. In conclusion, the findings of our study documented the beneficial use of GR and BAs to treat SARS-CoV-2 and its variants and prevent post-COVID cognitive impairment. However, it warrants further studies with a larger randomized sample size to ensure that the studies have sufficient evidence of benefits against COVID-19 and post-COVID-19 symptoms.

show abstract

“…3-O-acetyl-11-keto-β-boswellic acid (AKBA) is the major boswellic acid isolated from B. serrata [ 28 ]. Accumulating experimental and clinical data attest to the exceptional ability of AKBA to treat several disorders, including infection, cancer, sepsis, hypertension, arthritis, liver and brain damage, memory deficits, and colitis due to its potent antioxidant and anti-inflammatory effects [ 28 , 29 , 30 , 31 , 32 , 33 ]. In addition, studies have shown that AKBA can act on several cellular targets, including transcription and growth factors, as well as signaling mediators and pathways [ 28 ].…”

Section: Introductionmentioning

confidence: 99%

The Protective Effect of 11-Keto-β-Boswellic Acid against Diabetic Cardiomyopathy in Rats Entails Activation of AMPK

et al. 2023

View full text Add to dashboard Cite

This study examined the protective effect of 11-keto-β-boswellic acid (AKBA) against streptozotocin (STZ)-induced diabetic cardiomyopathy (DC) in rats and examined the possible mechanisms of action. Male rats were divided into 5 groups (n = 8/each): (1) control, AKBA (10 mg/kg, orally), STZ (65 mg/kg, i.p.), STZ + AKBA (10 mg/kg, orally), and STZ + AKBA + compound C (CC/an AMPK inhibitor, 0.2 mg/kg, i.p.). AKBA improved the structure and the systolic and diastolic functions of the left ventricles (LVs) of STZ rats. It also attenuated the increase in plasma glucose, plasma insulin, and serum and hepatic levels of triglycerides (TGs), cholesterol (CHOL), and free fatty acids (FFAs) in these diabetic rats. AKBA stimulated the ventricular activities of phosphofructokinase (PFK), pyruvate dehydrogenase (PDH), and acetyl CoA carboxylase (ACC); increased levels of malonyl CoA; and reduced levels of carnitine palmitoyltransferase I (CPT1), indicating improvement in glucose and FA oxidation. It also reduced levels of malondialdehyde (MDA); increased mitochondria efficiency and ATP production; stimulated mRNA, total, and nuclear levels of Nrf2; increased levels of glutathione (GSH), heme oxygenase (HO-1), superoxide dismutase (SOD), and catalase (CAT); but reduced the expression and nuclear translocation of NF-κB and levels of tumor-necrosis factor-α (TNF-α) and interleukin-6 (IL-6). These effects were concomitant with increased activities of AMPK in the LVs of the control and STZ-diabetic rats. Treatment with CC abolished all these protective effects of AKBA. In conclusion, AKBA protects against DC in rats, mainly by activating the AMPK-dependent control of insulin release, cardiac metabolism, and antioxidant and anti-inflammatory effects.

show abstract

Acetyl-11-Keto-β-Boswellic Acid (AKBA) Prevents Lipopolysaccharide-Induced Inflammation and Cytotoxicity on H9C2 Cells

Cited by 14 publications

References 61 publications

Carnosol Attenuates LPS-Induced Inflammation of Cardiomyoblasts by Inhibiting NF-κB: A Mechanistic in Vitro and in Silico Study

Carnosol Attenuates LPS-Induced Inflammation of Cardiomyoblasts by Inhibiting NF-κB: A Mechanistic in Vitro and in Silico Study

Glycyrrhizin and boswellic acids, the golden nutraceuticals: multitargeting for treatment of mild–moderate COVID-19 and prevention of post-COVID cognitive impairment

The Protective Effect of 11-Keto-β-Boswellic Acid against Diabetic Cardiomyopathy in Rats Entails Activation of AMPK

Contact Info

Product

Resources

About