Acetaldehyde, a Major Constituent of Tobacco Smoke, Enhances Behavioral, Endocrine, and Neuronal Responses to Nicotine in Adolescent and Adult Rats

Abstract

We have previously shown that acetaldehyde, a constituent of tobacco smoke, increases nicotine self-administration in adolescent, but not adult, rats. The aim of this study was to determine whether acetaldehyde influences other behavioral, endocrine, or neuronal responses to nicotine at either age. Juvenile (postnatal day (P) 27) and adult (P90) male Sprague-Dawley rats were treated with saline, acetaldehyde (16 mg/kg/injection  2, i.v.), nicotine (30 mg/kg/injection  2, i.v.) or a combination of acetaldehyde and nicotine. Locomotion and center time were evaluated for 30 min in a novel open field, before measurement of plasma corticosterone levels and brain c-fos mRNA. Nicotine increased locomotor activity in juveniles but decreased it in adults; in contrast, center time was increased at both ages. Acetaldehyde potentiated nicotine's locomotor effects, but not center time. Nicotine induced c-fos expression in the bed nucleus of the stria terminalis, the central nucleus of the amygdala (CeA), nucleus accumbens, and the superior colliculus (SC) at both ages, whereas it activated the hypothalamic paraventricular nucleus (PVN) and consequent corticosterone secretion only in adults. Acetaldehyde potentiated nicotine-induced c-fos in CeA and SC, and activation of PVN c-fos expression/plasma corticosterone release; however, this drug interaction was only observed in behaviorally tested animals, not those that were minimally stressed. Thus, acetaldehyde may modulate the interaction of nicotine and stress. Although pharmacokinetic studies showed that acetaldehyde did not change nicotine levels in either brain or serum, nicotine penetration into the brain was slower in juveniles as compared to adults.

Nicotine Alters Limbic Function in Adolescent Rat by a 5-HT1A Receptor Mechanism

“…Our data confirm and extend a previous finding that adolescents have greater nicotineinduced activation in the NAc shell (Shram et al, 2007). Although acute nicotine does not induce c-fos in BLA of adult animals (Cao et al, 2007a;Valjent et al, 2002;MathieuKia et al, 1998), we now show an adolescent-specific nicotine-induced activation of the BLA.…”

“…Two intravenous injections of nicotine (2 Â 30 mg/kg/0.1 ml), or saline, spaced 1 min apart, were administered daily for 4 consecutive days during early adolescence (P28-31), late adolescence (P37-40), or adulthood (P86-89). The daily nicotine dose used yields peak serum levels of approximately 30 ng/ml in both adolescents and adults (Cao et al, 2007a), which is well within the range of the average smoker. Intravenous injections of S-15535 (2 Â 15 or 2 Â 150 mg/kg) and 8-OH-DPAT (2 Â 5 mg/kg) were administered during early adolescence (P28-31).…”

Cigarette smoke and related risk factors in neurological disorders: An update

“…Moreover, parallel to other addictive drugs (cocaine and heroin), nicotine releases a neurotransmitter called dopamine, in the brain. Dopamine triggers an optimistic feeling in smokers and affects the brain pathway that controls reward and pleasure [19]. As a small amount of data revealed that cigarette smoke can reduce anxiety in some smokers, the correlation between smoking and anxiety is complicated.…”

Persistent overexpression of DNA methyltransferase 1 attenuating GABAergic inhibition in basolateral amygdala accounts for anxiety in rat offspring exposed perinatally to low-dose bisphenol A

“…NM_053354.3 CAGATGTTCCATGCACACT TGTGGATGTAGGAAAGTTGCA GAPDH AB017801.1 TCCCTCAAGATTGTCAGCAA AGATCCACAACGGATACATT environment and has been widely used to evaluate anxiogenic and anxiolytic effects of a drug in rodents (Cao et al, 2007;Frye et al, 2008;Prut and Belzung, 2003). As described by Cao et al (2007), each animal was placed into a 75 cm  75 cm white Plexiglas arena and videotaped continuously for 30 min to quantify time-dependent behaviors.…”