Accelerating genome editing in CHO cells using CRISPR Cas9 and CRISPy, a web‐based target finding tool

Abstract

Chinese hamster ovary (CHO) cells are widely used in the biopharmaceutical industry as a host for the production of complex pharmaceutical proteins. Thus genome engineering of CHO cells for improved product quality and yield is of great interest. Here, we demonstrate for the first time the efficacy of the CRISPR Cas9 technology in CHO cells by generating site-specific gene disruptions in COSMC and FUT8, both of which encode proteins involved in glycosylation. The tested single guide RNAs (sgRNAs) created an indel frequency up to 47.3% in COSMC, while an indel frequency up to 99.7% in FUT8 was achieved by applying lectin selection. All eight sgRNAs examined in this study resulted in relatively high indel frequencies, demonstrating that the Cas9 system is a robust and efficient genome-editing methodology in CHO cells. Deep sequencing revealed that 85% of the indels created by Cas9 resulted in frameshift mutations at the target sites, with a strong preference for single base indels. Finally, we have developed a user-friendly bioinformatics tool, named “CRISPy” for rapid identification of sgRNA target sequences in the CHO-K1 genome. The CRISPy tool identified 1,970,449 CRISPR targets divided into 27,553 genes and lists the number of off-target sites in the genome. In conclusion, the proven functionality of Cas9 to edit CHO genomes combined with our CRISPy database have the potential to accelerate genome editing and synthetic biology efforts in CHO cells. Biotechnol. Bioeng. 2014; 111: 1604–1616. © 2014 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

Glycosylation inhibition reduces cholesterol accumulation in NPC1 protein-deficient cells

“…Wild-type "AG10803" fibroblasts and "GM30123" P237S/I1061T NPC1-deficient human fibroblasts were from Coriell Cell Repositories; CHO ldl-D cells (24) were from Bill Balch (The Scripps Research Institute, San Diego). NPC1 knockout CHO ldl-D clones were generated using CRISPR to the target sequence GGCCTTCTCATTACTTGCAGGGG in exon 4 found using CRISPy (30). Guide sequence cloned into PX458 was transfected into CHO ldl-D cells using FuGene 6 (Promega).…”

One‐step generation of triple knockout CHO cell lines using CRISPR/Cas9 and fluorescent enrichment

“…Cloning of the GFP_2A_Cas9 was performed with seamless uracil-specific excision reagent (USER) cloning to insert GFP_2A directly upstream of the Cas9 reading frame in pJ607-Cas9 [3]. The uracil-containing primers are listed in Supplementary Table S1 and PCR (98°C for 2min; 35x: 98°C for 10s, 60°C for 45s, 72°C for 40s/5min; 72°C for 5min) was performed with the X7 DNA polymerase [13].…”

“…The sequence of the construct was verified by sequencing and purified plasmid was obtained using the NucleoBond® Xtra Midi kit (Macherey-Nagel) according to the manufacturer's recommendations. The online bioinformatic tool "CRISPy" was applied for sgRNA target selection for BAK and BAX [3].…”

“…Genome editing nucleases including meganucleases, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the more recent clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system have paved the way for rapid and efficient induction of DSBs at defined genomic sites, leading to site-specific gene manipulations by non-homologous end joining (NHEJ) repair or homology-directed repair (HDR) [2]. We have previously shown that the CRISPR Cas protein 9 (Cas9) genome editing tool is very efficient in CHO cells by generating NHEJmediated gene disruptions in two genes involved in glycosylation: fucosyltransferase 8 (FUT8) and COSMC encoding the C1GALT1-specific chaperone 1 [3]. In this system, a single-guide RNA (sgRNA) directs the Cas9 nuclease to cause DSBs in matching target DNA sequences if they are adjacent to short sequences known as protospacer adjacent motifs (PAMs) [4,5].…”

CasPER, a method for directed evolution in genomic contexts using mutagenesis and CRISPR/Cas9

“…To select for specific gRNAs targeting BTS1, HMG2, ERG12 and ERG20 we used the online CRISPy-web tool (Ronda et al, 2014). Selected gRNA sequences corresponded as follows: BTS1 -TAGCTGCGA TACAAGTTGCA; HMG2 -TGCTAGACATCTTCCCGGAT; ERG12 -GTT AATAGGATCTAATGACT and ERG20 -CTATGAAGGAGTGCTTCTTT.…”