Accelerated Phagocytosis of Amyloid-β by Mouse and Human Microglia Overexpressing the Macrophage Colony-stimulating Factor Receptor

Abstract

Alzheimer's disease (AD) 1 is characterized by amyloid-␤ peptide (A␤) plaques surrounded by microglia. A␤ is thought to be directly neurotoxic, and activated microglia are hypothesized to have negative effects on neurons through the release of effectors of inflammation (1). However, as brain macrophages microglia can clear A␤ by phagocytosis, primarily through macrophage scavenger receptors (MSR) (2-6). Immunization of transgenic mice modeling AD with A␤ results in clearance of plaques from the brain (7). Whereas some results suggest that microglial phagocytosis may be key in clearance of A␤ after immunization (8), other findings indicate that circulating antibodies may result in movement of A␤ out of the brain (9). This controversy has stimulated renewed interest in uptake of A␤ by microglia.A distinctive phenotypic feature of microglia surrounding A␤ plaques in APPV717F transgenic mice and in AD is enhanced expression of the macrophage colony-stimulating factor receptor (M-CSFR), translation product of the c-fms proto-oncogene (10, 11). Microglial M-CSFR expression is also increased after experimental ischemic and traumatic brain injury (12, 13). M-CSFR regulates proliferation, activation, and survival of cells in the monocyte-macrophage lineage through tyrosine kinase activation of diverse signal transduction pathways including: Src kinase, Ras-ERK, phosphoinositide 3-kinase, and p38 MAP kinase (14 -16). Deletion of M-CSFR expression results in decreased numbers of cells of the mononuclear phagocyte lineage (17). In AD macrophage colony-stimulating factor (M-CSF), the ligand for M-CSFR expressed by neurons and glia is also increased (18). Simultaneous increases in M-CSF and M-CSFR expression in the brain could result in significant changes in microglial function.We recently demonstrated that overexpression of M-CSFR by cultured microglia increases proliferation, stimulates release of pro-inflammatory and chemotactic cytokines, and induces a paracrine inflammatory response in a microglial-organotypic co-culture system (19). In the present study we sought to determine the effects of M-CSFR overexpression on A␤ phagocytosis by cultured mouse and human microglia. We hypothesized that M-CSFR-induced activation of microglia would increase their capacity to clear A␤ from culture medium. Although A␤ immunization clinical trials have been discontinued in humans for the present, identifying factors that enhance microglial clearance of A␤ may be of benefit in devising alternative means of decreasing A␤ burden in the brain in AD. EXPERIMENTAL PROCEDURES Microglial Cell Lines, Plasmid Transfections, and Tissue culture-The c-fms expression plasmid pTK1 was a gift from Dr. Rao Tekmal (Emory University, Atlanta, GA), and contains the complete mouse c-fms sequence under the control of an SV40 promoter (20). Transfections were carried out using mouse BV-2 and human SV-A3 microglial cells. The BV-2 immortalized microglial cell line has been characterized previously (21)(22)(23)(24). Because of phenotypic changes that occur at...

Physiology of Microglia

“…The corresponding receptor, the M-CSF receptor (M-CSFR; encoded by protooncogene c-fms), is expressed in activated microglial cells surrounding neuritic plaques in AD and also in microglia after traumatic or ischemic brain insults (593)(594)(595). The activation of M-CSFR stimulates release of NO and proinflammatory cytokines and also promotes phagocytosis and the uptake of A␤ (593)(594)(595). Overexpression of M-CSFR in microglia had a significant neuroprotective effect in organotypic hippocampal slices subjected to excitotoxic stress (592).…”

Combination of retinoic acid and tumor necrosis factor overcomes the maturation block in a variety of retinoic acid-resistant acute promyelocytic leukemia cells

“…[49][50][51] We also used this approach to determine whether the m-CSF-1R pathway is an essential mediator of the promonocytic effects of TNF and RA. As shown in Figure 1, the monocyte-specific marker CD14 was increased in a synergistic fashion on treatment with TNF and RA.…”

Identification of Cathepsin B as a Mediator of Neuronal Death Induced by Aβ-activated Microglial Cells Using a Functional Genomics Approach

“…The corresponding sequences are aagaagctgtgtggcactgtc for cathepsin B, aagtccacgcacagaagactg for cathepsin L, aaggagtatctaattgcagga for TIMP2, and aacaagcaattcctcgatgat for AIF. The transient transfections with siRNAs were performed with LipofectAMINE Plus Reagent (Invitrogen) as described previously (23). Three hours after transfection, the cultures were washed once and incubated with DMEM/F12/N2 overnight.…”