Abundance of Pathogenic Escherichia coli Virulence-Associated Genes in Well and Borehole Water Used for Domestic Purposes in a Peri-Urban Community of South Africa

Abstract

In the absence of pipe-borne water, many people in Africa, especially in rural communities, depend on alternative water sources such as wells, boreholes and rivers for household and personal hygiene. Poor maintenance and nearby pit latrines, however, lead to microbial pollution of these sources. We evaluated the abundance of Escherichia coli and the prevalence of pathogenic E. coli virulence genes in water from wells, boreholes and a river in a South African peri-urban community. Monthly samples were collected between August 2015 and November 2016. In all, 144 water samples were analysed for E. coli using the Colilert 18 system. Virulence genes (eagg, eaeA, stx1, stx2, flichH7, ST, ipaH, ibeA) were investigated using real-time polymerase chain reaction. Mean E. coli counts ranged between 0 and 443.1 Most Probable Number (MPN)/100 mL of water sample. Overall, 99.3% of samples were positive for at least one virulence gene studied, with flicH7 being the most detected gene (81/140; 57.6%) and the stx2 gene the least detected gene (8/140; 5.7%). Both intestinal and extraintestinal pathogenic E. coli genes were detected. The detection of virulence genes in these water sources suggests the presence of potentially pathogenic E. coli strains and is a public health concern.

Mixed Aetiology of Diarrhoea in Infants Attending Clinics in the North-West Province of South Africa: Potential for Sub-Optimal Treatment

“…Extracted DNA templates were tested for the presence of the malate dehydrogenase (mdh) gene, which is found in most E. coli strains. Isolates that harboured the mdh gene were tested for the presence of eight VGs-eaeA (EPEC/EHEC), eagg (EAEC), ipaH (EIEC), ST and LT (ETEC), stx1, stx2 and flicH7 (EHEC)-as previously described [106,107]. All the PCR assays included a positive control consisting of DNA from a reference strains obtained from the Microbiology Laboratories of the Natural Resources and the Environment (NRE) and CSIR, as well as previously characterised by Abia et al [101].…”

Antibiotic Resistance Profile and Clonality of E. coli Isolated from Water and Paediatric Stool Samples in the North-West, Province South Africa

“…Extracted DNA templates were first examined for the presence of the malate dehydrogenase (mdh) gene to confirm the isolates as being E. coli 47 . Isolates harbouring the mdh gene were further separated into five DEC pathotypes, EPEC, EAEC,EIEC, ETEC, EHEC targeting specific VGs through multiplex and singleplex PCR assays and using primers and PCR-cycling conditions described by Abia et al 6 . Multiplex PCR Group 1 contained the stx1 and flicH7 genes, Group 2 contained eaeA, ipaH, and eagg genes and Group 3 contained the stx2 gene.…”

“…ST and LT genes were detected through Singleplex PCR. The ST gene was amplified using primer sequence Forward: TTTCCCCTCTTTTAGTCAGTCAA and reverse: GCAGGATTACAACACAATTCACAGCAG with the temperature conditions used for the detection of mdh gene 6 . The PCR assay for LT gene was performed using a 218 bp primer (Forward: GCACACGGAGCTCCTCAGTC)and (Reverse: TCCTTCATCCTTTCAATGGCTTT) with an initial activation at 95°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 1 min and an extension at 72°C for 1 min.…”

“…All reactions were performed in a total volume of 20µl made up of 10µl of 2x SensiFAST TM high-resolution melt (HRM) mix (SF) (Bioline GmbH, Germany), 0.5µl of primer (forward and reverse; final concentration 0.5µM each), 5µl of nuclease-free water (NF H 2 0) and 4µl DNA template. All assays included a positive control consisting of DNA from a reference strain obtained from the Microbiology Laboratory of the NRE, CSIR and previously characterised by Abia et al (2016) 6 . A reaction mixture void of template DNA was also added in each PCR assay as a No Template Control.…”

“…About 760,000 children lose their lives every year to diarrhoeal diseases worldwide 5 . Diarrhoeagenic E. coli pathotypes are ubiquitous in the environment, especially in aquatic environments 5,6 and are most often responsible for waterborne diarrhoeal disease outbreaks both in developed and developing countries [6][7][8] . For example, they were responsible for the second largest waterborne diarrhoea outbreak in the world reported in 2011 in Germany, which recorded over 3,000 hospitalisations and 36 fatalities 8 .…”