Abstract 3142: Derivation and analysis of preclinical models of human her-2 positive breast cancer

Abstract

Although a number of Her-2 targeting drugs are now available for the treatment of Her-2 positive breast cancers, resistance to these therapies rapidly emerges. There is therefore a need to study how Her-2 targeting strategies work in vivo, and the mechanisms by which tumors eventually become resistant to anti-Her-2 therapies. We report the in vivo selection of variants of the human Her-2 positive breast cancer cell lines BT474 and MDA-MB361. Both cell lines were initially implanted orthotopically into Severely Compromised Immunodeficient mice, and the resulting tumors were serially passaged into new hosts over a 4 year period. This selection process produced the BT474V3 and MDA361V3 variants, which grow rapidly in vivo and which retain their Her-2 over-expression, and which respond (p<0.05, relative to controls) to trastuzumab (20mg/kg i.p. every 3 days). Tumor variants were also derived from selected tumors that relapsed after 3 months of continuous trastuzumab monotherapy. MDA361V3 tumors showed a significant (p<0.05) response to the combination therapy of trastuzumab plus metronomic cyclophosphamide (20mg/kg/day, p.o.). Tumors eventually progressed under this combination therapy, and cell lines were derived from the drug resistant tumors. Non-invasive monitoring of the Her-2 positive models in vivo was achieved by luciferase transfection of the tumor variants, or by transfection of chorionic gonadotropin (hCG) cDNA which allows for relative tumor growth to be evaluated via the resulting hCG levels in the mouse urine. Luciferase transfected BT474V3 were implanted intracranially (coordinates for implantation from Bregma were AP, +1.1; LM, -2.0; and DV, -3), and bioluminescence was detectable 20 days later. The implanted tumors in the brain eventually showed a doubling of bioluminescence every 2 weeks, which provides ample time for therapeutic intervention in this model of Her-2 positive breast cancer brain metastasis. To further model the response of Her-2 positive metastatic breast cancer, we employed our met2.hCG model, derived from the human MDA-MB-231 human breast cancer cell line. Thus, MDA-MB-231 were transduced to overexpress Her-2, then tagged with hCG, and then selected for high spontaneous metastatic capacity. Orthotopically implanted met2.hCG tumors responded to trastuzumab as a monotherapy, and when given in combination with metronomic cyclophosphamide. Following surgical removal of the orthotopically implanted met2.hCG tumors, urine hCG levels indicated that the metastases also responded (p<0.05, compared to saline treated controls) to the combination of metronomic cyclophosphamide plus trastuzumab, but they did not respond to the trastuzumab monotherapy. Collectively, our data shows that we have derived models of Her-2 positive breast cancer that can be used to evaluate anti-Her-2 therapeutic strategies, and to study the emergence of resistance to anti-Her-2 based therapies. Citation Format: Paloma A. Valenzuela, Sarah N. Jallad, Karla Parra, Natzidielly Lerma, Irving Miramontes, Alejandra Gallegos, Ping Xu, William Cruz-Munoz, Shan Man, Robert S. Kerbel, Giulio Francia. Derivation and analysis of preclinical models of human her-2 positive breast cancer. [abstract]. In: Proceedings of the 105th Annual Meeting of the American Association for Cancer Research; 2014 Apr 5-9; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2014;74(19 Suppl):Abstract nr 3142. doi:10.1158/1538-7445.AM2014-3142

Targeted Nanoparticle for Co‐delivery of HER2 siRNA and a Taxane to Mirror the Standard Treatment of HER2+ Breast Cancer: Efficacy in Breast Tumor and Brain Metastasis

“…siHER2 Sense: 5' CACGUUUGAGUCCAUGCCCAAUU 3' Antisense: 5' UUGGGCAUGGACUCAAACGUGUU 3' siLUC Sense: 5' CGGAUUACCAGGGAUUUCAtt 3' Antisense: 5' UGAAAUCCCUGGUAAUCCGtt 3' siSCR Sense: 5' UGGUUUACAUGUCGACUAA 3' Antisense: 5' UUAGUCGACAUGUAAACCA 3' Human breast cancer cell lines (BT474, HCC1954, MCF7) were obtained from American Type Culture Collection. LM2-4luc+/H2N [26,27] and BTGFL1 [28] were gifted by Prof. Robert Kerbel (University of Toronto, Canada) and Giulio Francia (The University of Texas at El Paso). MCF7 was maintained in DMEM media supplemented with 10% FBS.…”

“…Robert Kerbel and Giulio Francia, which was serially passaged orthotopically in mice in a similar manner as BT474-TRgf, but for over 4 years. [28] The microbubblefacilitated focused ultrasound system (MB-FUS) was designed to allow effective BBB disruption, which can be conducted in the absence of MRI targeting (Figure S4a,b, Supporting Information). The site of initial tumor implantation was used as the reference point for targeting (Figure S4c, Supporting Information).…”