Aberrant methylation of CDH13 gene in nasopharyngeal carcinoma could serve as a potential diagnostic biomarker

Sun, Di; Zhang, Zhe; Van, Do Nguyen; Huang, Guangwu; Ernberg, Ingemar; Hu, Li–Fu

doi:10.1016/j.oraloncology.2006.01.007

Cited by 60 publications

(39 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[16][17][18] Furthermore, there is a growing body of evidence showing that abnormal methylation of DNA can be an early event in carcinogenesis and can serve as an early cancer detection biomarker, 15 including in EAC. [17][18][19][20] Hypermethylation of CDH13 has been described in many human cancers, 8,14,[21][22][23][24][25][26][27][28][29] including ESCC 24,29 ; however, hypermethylation of CDH13 in precancerous lesions such as Barrett's metaplasia (BE), as well as in BE-associated EAC, is an area that still remains to be explored. We investigated hypermethylation of the CDH13 promoter by real-time quantitative methylation-specific PCR (qMSP) in 259 endoscopic esophageal biopsy specimens of differing histologies and correlated these data with clinicopathological features.…”

mentioning

confidence: 99%

Promoter hypermethylation of CDH13 is a common, early event in human esophageal adenocarcinogenesis and correlates with clinical risk factors

Jin

Cheng

Olaru

et al. 2008

Intl Journal of Cancer

View full text Add to dashboard Cite

Although the CDH13 gene has been shown to undergo epigenetic silencing by promoter methylation in many types of tumors, hypermethylation of this gene in Barrett's-associated esophageal adenocarcinogenesis has not been studied. Two hundred fifty-nine human esophageal tissues were therefore examined for CDH13 promoter hypermethylation by real-time methylation-specific PCR. CDH13 hypermethylation showed discriminative receiveroperator characteristic curve profiles, sharply demarcating esophageal adenocarcinoma (EAC) from esophageal squamous cell carcinoma (ESCC) and normal esophagus (NE) (p < 0.0001). CDH13 normalized methylation values (NMV) were significantly higher in Barrett's esophagus (BE), dysplastic BE (D) and EAC than in NE (p < 0.0000001). CDH13 hypermethylation frequency was 0% in NE but increased early during neoplastic progression, rising to 70% in BE, 77.5% in D and 76.1% in EAC. Both CDH13 hypermethylation frequency and its mean NMV were significantly higher in BE with than without accompanying EAC. In contrast, only 5 (19.2%) of 26 ESCCs exhibited CDH13 hypermethylation. Furthermore, both CDH13 hypermethylation frequency and its mean NMV were significantly higher in EAC than in ESCC, as well as in BE or D vs. ESCC. Interestingly, mean CDH13 NMV was significantly lower in short-segment than in long-segment BE, a known clinical risk factor for neoplastic progression. Similarly, BE segment length was significantly lower in specimens with unmethylated than with methylated CDH13 promoters. 5-aza-2 0 -deoxycytidine treatment of OE33 EAC and KYSE220 ESCC cells reduced CDH13 methylation and increased CDH13 mRNA expression. These findings suggest that hypermethylation of CDH13 is a common, tissue-specific event in human EAC, occurs early during BE-associated neoplastic progression, and correlates with known clinical neoplastic progression risk factors. ' 2008 Wiley-Liss, Inc.Key words: CDH13; hypermethylation; EAC; ESCC CDH13 (also known as H-cadherin and T-cadherin), a member of the cadherin gene superfamily, was isolated and has been mapped to 16q24, 1 a locus that frequently undergoes deletion in human cancers, including esophageal carcinoma. 2,3 In contrast to other known cadherins such as E-cadherin, N-cadherin and P-cadherin, which are transmembrane proteins, CDH13 lacks conventional transmembrane and cytoplasmic domains and is attached to the plasma membrane through a glycosyl phosphatidyl inositol anchor.1,4-6 Several studies have suggested that CDH13 functions as a tumor suppressor gene and possesses potent antitumor activity in several human cancers both in vitro and in vivo.7-10 Overexpression of CDH13 in human breast carcinoma cells (MDAMB435) reduced their invasive potential in vitro and tumor formation in vivo, accompanied by reversion from invasive to normal cell morphology.7 Loss of CDH13 protein expression is associated with tumorigenicity of human non-small cell lung cancer cells. 8,9 In cutaneous squamous cell carcinoma cells, overexpression of CDH13 induced a delay in the G 2 /M phase of...

show abstract

mentioning

confidence: 99%

Promoter hypermethylation of CDH13 is a common, early event in human esophageal adenocarcinogenesis and correlates with clinical risk factors

Jin

Cheng

Olaru

et al. 2008

Intl Journal of Cancer

View full text Add to dashboard Cite

show abstract

“…It has been shown that some genes are high frequently methylated in tumor tissue DNA obtained from NPC primary tumors, but not in normal tissues (Pan et al 2005;Sun et al 2007;Zhang et al 2007;Li, Shu, et al 2011). These genes are ideal candidate to serve as biomarkers for detection of NPC.…”

Section: Dna Methylation Results From Tumor Tissuesmentioning

confidence: 99%

“…Loss of intercellular adhesion allows malignant cells to escape from their site of origin, degrade the extracellular matrix, acquire a more motile and invasion phenotype, and finally, invade and metastasize. In NPC, epigenetic mechanism was involved in the abnormal cell adhesion, a diverse of molecules such as cadherins, connexins, and other components of cell adhesion are dysregulated (Du et al 2011;Sun et al 2007;Ying et al 2006;Huang et al 2001;Lou, Chen, Lin, et al 1999;Xiang et al 2002).…”

Section: Cell Adhesionmentioning

confidence: 99%

Epigenetics of Nasopharyngeal Carcinoma

Zhang¹,

Fu²,

Kuang³

et al. 2012

Carcinogenesis, Diagnosis, and Molecular Targeted Treatment for Nasopharyngeal Carcinoma

Self Cite

View full text Add to dashboard Cite

“…Primer sequences for CDH13 cDNA were designed according to Sun [18], generating a 203-bp PCR product: CDH13-RTforward: TTCAGCAGAAAGTGTTCCATAT and CDH13-RTreverse: GTGCATGGACGAACAGAGT. PCR was carried out in a total volume of 20 μl system.…”

Section: Semi-quantitative Rt-pcrmentioning

confidence: 99%

“…CDH13 (also known as H-cadherin and T-cadherin) is a member of the cadherin gene super family which was isolated and mapped to 16q24. CDH13 hypermethylation has been documented in breast [6][7][8] , lung cancers [9][10][11], pituitary adenomas [12,13], diffuse large B cell lymphoma [14], nasopharyngeal carcinoma [15][16][17][18] and cutaneous squamous cell carcinomas [19,20]. CDH13 has been suggested as an early marker for lung cancers [21].…”

Section: Introductionmentioning

confidence: 99%

CDH13 is Frequently Inactivated by Promoter Hypermethylation in Pediatric Acute Myeloid Leukemia

Tao¹,

Feng²,

Wang³

et al. 2013

J Hematol Thrombo Diseases

View full text Add to dashboard Cite

There is growing evidence supporting a role for tumor suppressor as targets in aberrant mechanisms of DNA hypermethylation. Methylation in the promoter of tumor suppressor always plays important roles in pediatric Acute Myeloid Leukemia (AML). CDH13 gene is a tumor suppressor involved in tumorigenesis, metastasis and apoptosis in a variety of tumors. In this study, we are trying to investigate whether CDH13 was down regulated by promoter methylation in pediatric AML. MRNA transcriptional expression levels of CDH13 were evaluated by semi-quantitative PCR and real-time PCR. Methylation status of CDH13 prompter was investigated by Methylation Specific PCR (MSP) and Bisulfate Genomic Sequencing (BGS). CDH13 mRNA transcription was inactivated in AML cell lines. Promoter of CDH13 was aberrantly methylated in 55.6% (5/9) leukemia cell lines. Promoter aberrant methylation of CDH13 was detected in 34.2% (24/70) of the cases of pediatric AML. The methylation of CDH13 promoter could be detected in all FAB subtypes. There were no significant differences in clinical features between patients with and without CDH13 methylation. Expression of CDH13 was significantly lower in AML patients group compared to normal bone marrow (NBM) control samples .The expression of CDH13 in thirty controls was significantly higher than pediatric AML patients. Both patients with CDH13 methylation (n=24) and those without CDH13 methylation (n=46) had significantly lower CDH13 transcript than controls (p<0.001). CDH13 transcript was significantly lower in patients with methylated CDH13 than those without methylated CDH13 (p=0.036). Inactivation of CDH13 by promoter hypermethylation is frequent event in pediatric AML. Our results suggest that hypermethylation of CDH13 promoter might be one of early events in the development of pediatric AML.

show abstract

Aberrant methylation of CDH13 gene in nasopharyngeal carcinoma could serve as a potential diagnostic biomarker

Cited by 60 publications

References 17 publications

Promoter hypermethylation of CDH13 is a common, early event in human esophageal adenocarcinogenesis and correlates with clinical risk factors

Promoter hypermethylation of CDH13 is a common, early event in human esophageal adenocarcinogenesis and correlates with clinical risk factors

Epigenetics of Nasopharyngeal Carcinoma

CDH13 is Frequently Inactivated by Promoter Hypermethylation in Pediatric Acute Myeloid Leukemia

Contact Info

Product

Resources

About