Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells

Arai, Rumi; En, Atsuki; Ukekawa, Ryo; Miki, Kensuke; Fujii, Michihiko; Ayusawa, Dai

doi:10.1016/j.bbrc.2016.04.018

Cited by 11 publications

(10 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In addition to protein accumulation, a body of evidence indicates that dysregulation of chromatin has a role in cellular senescence [17]. Consistent with this, we have previously found that lamin B receptor (LBR), a nuclear membrane protein that regulates heterochromatin organization [18], shows aberrant localization and down-regulation in senescent cells [19,20]. In addition, we showed that knockdown of LBR induces cellular senescence in TIG-7 cells [20].…”

supporting

confidence: 74%

“…The LBR sequence was cut out from the plasmid carrying LBR cDNA [19] and inserted into pcDNA3.1(À) (Invitrogen, Carlsbad, CA, USA) at the EcoRV site to make the plasmid termed pcDNA3.1(À)-LBR, which expresses LBR from the human CMV promoter. The LBR sequence [the XbaI-EcoRI fragment of pcDNA3.1(À)-LBR] was cloned into pUHD10-3 (H. Bujard, University of Heidelberg) to make the plasmid termed pUHD-LBR, which expresses LBR in a doxycycline (Dox)-dependent manner.…”

Section: Construction Of Lbr Expression Plasmidsmentioning

confidence: 99%

“…The LBR sequence [the XbaI-EcoRI fragment of pcDNA3.1(À)-LBR] was cloned into pUHD10-3 (H. Bujard, University of Heidelberg) to make the plasmid termed pUHD-LBR, which expresses LBR in a doxycycline (Dox)-dependent manner. To remove the putative motif for chaperone-mediated autophagy from the LBR sequence, QADIK (103-107) was replaced with QADAA by amplification of the N-terminal LBR sequence by PCR with the primers 5 0 -TGGTCGACCACCTAAAAG TGCCCGCCGATCTGCTTCTGCTTCCCACCAGGCCG ACGCTGCAGAAGCAAGG-3 0 and 5 0 -GCGGATCCTCG TAGATGTATGGAAATATACG-3 0 , and subsequent cloning of the amplified sequence into pCMV-LBR-GFP [19] after digestion with SalI and BamHI. The resulting plasmid, pCMV-LBR(QADAA)-GFP, expresses the altered LBR protein fused with GFP from the human CMV promoter.…”

Section: Construction Of Lbr Expression Plasmidsmentioning

confidence: 99%

See 2 more Smart Citations

Lamin B receptor plays a key role in cellular senescence induced by inhibition of the proteasome

Takauji

Miki

et al. 2020

FEBS Open Bio

Self Cite

View full text Add to dashboard Cite

Cellular senescence is a terminal growth arrest phenomenon in mammalian cells. Coordinated regulation of protein synthesis and degradation is required to maintain protein homeostasis in cells; however, senescent cells exhibit decreased activity of the proteasome, a major cellular proteolytic machinery, with an accumulation of proteins. Indeed, we showed that MG132, a proteasome inhibitor, induced cellular senescence through an accumulation of proteins in human cells. We then investigated the mechanisms of cellular senescence induced by protein accumulation by treating cells with MG132. We found that lamin B receptor (LBR), a nuclear membrane protein that regulates heterochromatin organization, was mislocalized and down‐regulated in cells on treatment with MG132. Importantly, enforced expression of LBR suppressed cellular senescence induced by MG132. We also showed that LBR was involved in the regulation of chromatin organization in senescent cells, and that endoplasmic reticulum stress and autophagy were likely to be involved in the mislocalization and down‐regulation of LBR. These findings indicate that decreased LBR function was responsible for the induction of cellular senescence by MG132, and thus suggest that protein accumulation caused by inhibition of the proteasome induced cellular senescence probably through chromatin dysregulation in human cells.

show abstract

supporting

confidence: 74%

Section: Construction Of Lbr Expression Plasmidsmentioning

confidence: 99%

Section: Construction Of Lbr Expression Plasmidsmentioning

confidence: 99%

See 1 more Smart Citation

Lamin B receptor plays a key role in cellular senescence induced by inhibition of the proteasome

Takauji

Miki

et al. 2020

FEBS Open Bio

Self Cite

View full text Add to dashboard Cite

show abstract

“…QRT-PCR was performed for a panel of genes previously reported to be miR-29 targets, seed-matched target genes of miR-29, and/or genes consistent with the expected mechanism of action of miR-29 in repressing collagen/ECM expression (Boon et al, 2011;Cheng et al, 2013;Kriegel et al, 2012;Zhu et al, 2016a) and cell proliferation/differentiation (Roderburg et al, 2011;Wei et al, 2013, Zhu et al, 2016a. These genes include numerous collagens, elastin, transforming growth factor (TGF)-b isoforms, the Notch inhibitor Numb (Flores et al, 2014), the antifibrotic proteoglycan SDC4 (Jiang et al, 2010), the ECM receptor ITGA3 (Jiang et al, 2010;Longmate et al, 2017), the lamin B receptor LBR (Arai et al, 2016) and the plasma membrane trafficking regulator SNX27 (Yang et al, 2018), and others (Supplementary Table S1 online). A dose-dependent regulation of those PD biomarkers was observed ( Figure 1) in vivo via QRT-PCR.…”

Section: Resultsmentioning

confidence: 81%

A MicroRNA-29 Mimic (Remlarsen) Represses Extracellular Matrix Expression and Fibroplasia in the Skin

Gallant‐Behm

Piper

Lynch

et al. 2019

Journal of Investigative Dermatology

173

118

View full text Add to dashboard Cite

MicroRNA-29 (miR-29) negatively regulates fibrosis and is downregulated in multiple fibrotic organs and tissues, including in the skin. miR-29 mimics prevent pulmonary fibrosis in mouse models but have not previously been tested in the skin. This study aimed to identify pharmacodynamic biomarkers of miR-29 in mouse skin, to translate those biomarkers across multiple species, and to assess the pharmacodynamic activity of a miR-29b mimic (remlarsen) in a clinical trial. miR-29 biomarkers were selected based on gene function and mRNA expression using quantitative reverse transcriptase polymerase chain reaction. Those biomarkers comprised multiple collagens and other miR-29 direct and indirect targets and were conserved across species; remlarsen regulated their expression in mouse, rat, and rabbit skin wounds and in human skin fibroblasts in culture, while a miR-29 inhibitor reciprocally regulated their expression. Biomarker expression translated to clinical proof-ofmechanism; in a double-blinded, placebo-randomized, within-subject controlled clinical trial of single and multiple ascending doses of remlarsen in normal healthy volunteers, remlarsen repressed collagen expression and the development of fibroplasia in incisional skin wounds. These results suggest that remlarsen may be an effective therapeutic to prevent formation of a fibrotic scar (hypertrophic scar or keloid) or to prevent cutaneous fibrosis, such as scleroderma.

show abstract

“…Furthermore, similarly to the differentiation state of normal cells, induction of cellular senescence by oncogene activation or by γ-irradiation significantly decreased the levels of LBR, while heterochromatin detached from the INM and condensed in the nuclear interior into irregular structures resembling cords [ 11 , 65 ]. Yet, according to another report, LBR was redistributed in the nucleoplasm and also in the cytoplasm of Hela cells following 5-bromodeoxyuridine-induced senescence [ 66 ]. In all three reports, a significant decrease of lamin B expression was observed, implying that the regulation of both LBR and lamin B is interrelated.…”

Section: The Intricate Roles Of Lbr At the Nuclear Envelopementioning

confidence: 99%

Lamin B Receptor: Interplay between Structure, Function and Localization

Nikolakaki

Mylonis

Giannakouŕos

2017

Cells

View full text Add to dashboard Cite

Lamin B receptor (LBR) is an integral protein of the inner nuclear membrane, containing a hydrophilic N-terminal end protruding into the nucleoplasm, eight hydrophobic segments that span the membrane and a short, nucleoplasmic C-terminal tail. Two seemingly unrelated functions have been attributed to LBR. Its N-terminal domain tethers heterochromatin to the nuclear periphery, thus contributing to the shape of interphase nuclear architecture, while its transmembrane domains exhibit sterol reductase activity. Mutations within the transmembrane segments result in defects in cholesterol synthesis and are associated with diseases such as the Pelger–Huët anomaly and Greenberg skeletal dysplasia, whereas no such harmful mutations related to the anchoring properties of LBR have been reported so far. Recent evidence suggests a dynamic regulation of LBR expression levels, structural organization, localization and function, in response to various signals. The molecular mechanisms underlying this dynamic behavior have not yet been fully unraveled. Here, we provide an overview of the current knowledge of the interplay between the structure, function and localization of LBR, and hint at the interconnection of the two distinct functions of LBR.

show abstract

Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells

Cited by 11 publications

References 37 publications

Lamin B receptor plays a key role in cellular senescence induced by inhibition of the proteasome

Lamin B receptor plays a key role in cellular senescence induced by inhibition of the proteasome

A MicroRNA-29 Mimic (Remlarsen) Represses Extracellular Matrix Expression and Fibroplasia in the Skin

Lamin B Receptor: Interplay between Structure, Function and Localization

Contact Info

Product

Resources

About