AAR2, a gene for splicing pre-mRNA of the MATa1 cistron in cell type control of Saccharomyces cerevisiae.

Nakazawa, N; Harashima, Satoshi; Oshima, Y

doi:10.1128/mcb.11.11.5693

Cited by 20 publications

(12 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Expression was assayed by primer extension, using 20 g RNA for GAL1 and 40 g RNA for GAL10 and ACT1. The primers used were GAL1-1 (CCTTGACGTTAAAGTATAGAGG), GAL10-1 (CAATGTATCCAGCACCACCTGT) (21), and ACT1-1 (AACCGT TATCAATAACCAAAGC) (33). GAL1 and GAL10 expression was quantitated and normalized to ACT1 expression.…”

Section: Methodsmentioning

confidence: 99%

Targets of the Gal4 Transcription Activator in Functional Transcription Complexes

Reeves

Hahn

2005

Molecular and Cellular Biology

125

110

View full text Add to dashboard Cite

Although biochemical and genetic methods have detected many activator-transcription factor interactions, the direct functional targets of most activators remain undetermined. For this study, photo-cross-linkers positioned within the Gal4 C-terminal acidic activating region were used to identify polypeptides in close physical proximity to Gal4 during transcription activation in vitro. Of six specifically cross-linked polypeptides, three (Tra1, Taf12, and Gal11) are subunits of four complexes (SAGA, Mediator, NuA4, and TFIID) known to play a role in gene regulation. These cross-linking targets had differential effects on activation. SAGA was critical for activation by Gal4, Gal11 contributed modestly to activation, and TFIID and NuA4 were not important for activation under our conditions. Tra1, Taf12, and Gal11 have also been identified as crosslinking targets of the Gcn4 acidic central activating region. Our results demonstrate that two unrelated acidic activators converge on the same set of functional targets.

show abstract

Section: Methodsmentioning

confidence: 99%

Targets of the Gal4 Transcription Activator in Functional Transcription Complexes

Reeves

Hahn

2005

Molecular and Cellular Biology

125

110

View full text Add to dashboard Cite

show abstract

“…Pre-U5 snRNP lacks the Brr2 helicase and instead includes the Aar2 protein (Gottschalk et al 2001;Boon et al 2007), which has been originally characterized as a factor involved in pre-mRNA splicing of the MATa1 transcript in Saccharomyces cerevisiae (Nakazawa et al 1991). We recently found that Aar2p and Brr2p bind, respectively, to an RNase H-like (RH) domain and a Jab1/MPN-like (Jab1) domain that lie next to each other in the C-terminal region of the Prp8 protein (Weber et al 2011).…”

mentioning

confidence: 99%

Structural basis for dual roles of Aar2p in U5 snRNP assembly

et al. 2013

View full text Add to dashboard Cite

Yeast U5 small nuclear ribonucleoprotein particle (snRNP) is assembled via a cytoplasmic precursor that contains the U5-specific Prp8 protein but lacks the U5-specific Brr2 helicase. Instead, pre-U5 snRNP includes the Aar2 protein not found in mature U5 snRNP or spliceosomes. Aar2p and Brr2p bind competitively to a C-terminal region of Prp8p that comprises consecutive RNase H-like and Jab1/MPN-like domains. To elucidate the molecular basis for this competition, we determined the crystal structure of Aar2p in complex with the Prp8p RNase H and Jab1/MPN domains. Aar2p binds on one side of the RNase H domain and extends its C terminus to the other side, where the Jab1/MPN domain is docked onto a composite Aar2p-RNase H platform. Known Brr2p interaction sites of the Jab1/ MPN domain remain available, suggesting that Aar2p-mediated compaction of the Prp8p domains sterically interferes with Brr2p binding. Moreover, Aar2p occupies known RNA-binding sites of the RNase H domain, and Aar2p interferes with binding of U4/U6 di-snRNA to the Prp8p C-terminal region. Structural and functional analyses of phosphomimetic mutations reveal how phosphorylation reduces affinity of Aar2p for Prp8p and allows Brr2p and U4/U6 binding. Our results show how Aar2p regulates both protein and RNA binding to Prp8p during U5 snRNP assembly.[Keywords: assembly chaperone; pre-mRNA splicing; regulation by phosphorylation; snRNP biogenesis and recycling; X-ray crystallography] Supplemental material is available for this article. Uridine-rich (U) small nuclear ribonucleoprotein particles (snRNPs) are the main subunits of spliceosomes, the large and dynamic RNP machineries required for the removal of noncoding introns from eukaryotic precursor messenger RNAs (pre-mRNAs) and the ligation of neighboring coding exons. The major spliceosome is built from the U1, U2, U4, U5, and U6 snRNPs, each of which contains an individual small nuclear RNA (snRNA), seven common Sm proteins (or like-Sm [LSm] proteins in the case of U6), and a variable set of particle-specific proteins (for review, see Will and Lü hrmann 2001).A hallmark of the spliceosome is its stepwise assembly from snRNPs and many non-snRNP factors only in the presence of a substrate pre-mRNA (for review, see Wahl et al. 2009). During this process, the spliceosome is repeatedly remodeled with the help of eight highly conserved DEXD/H-box ATPases/RNA helicases (for review, see Staley and Guthrie 1998). Among these enzymes, the U5-specific Brr2 protein is required for the catalytic activation of an initial inactive spliceosomal assembly and again during the ordered disassembly of the postsplicing complex (for review, see Hahn and Beggs 2010). Brr2p is regulated by two other U5 snRNP proteins: Prp8p, considered the master regulator of the spliceosome (for review, see Grainger and Beggs 2005), and Snu114p, a complex G protein that resembles the ribosomal translocase eEF2 (Bartels et al. 2002(Bartels et al. , 2003Brenner and Guthrie 2005;Small et al. 2006).The Sm-type snRNPs themselves are also assemb...

show abstract

“…Aar2p was discovered as a factor involved in the splicing of some pre-mRNAs in yeast (Nakazawa et al 1991). While Aar2p is not required for splicing per se, removal of the protein blocked repeated rounds of splicing in vitro (Gottschalk et al 2001), suggesting that it could be involved in U5 snRNP or U4/U6-U5 tri-snRNP (re)assembly.…”

mentioning

confidence: 99%

Mechanism for Aar2p function as a U5 snRNP assembly factor

Weber¹,

Cristão²,

Alves³

et al. 2011

Genes Dev.

View full text Add to dashboard Cite

Little is known about how particle-specific proteins are assembled on spliceosomal small nuclear ribonucleoproteins (snRNPs). Brr2p is a U5 snRNP-specific RNA helicase required for spliceosome catalytic activation and disassembly. In yeast, the Aar2 protein is part of a cytoplasmic precursor U5 snRNP that lacks Brr2p and is replaced by Brr2p in the nucleus. Here we show that Aar2p and Brr2p bind to different domains in the C-terminal region of Prp8p; Aar2p interacts with the RNaseH domain, whereas Brr2p interacts with the Jab1/MPN domain. These domains are connected by a long, flexible linker, but the Aar2p-RNaseH complex sequesters the Jab1/MPN domain, thereby preventing binding by Brr2p. Aar2p is phosphorylated in vivo, and a phospho-mimetic S253E mutation in Aar2p leads to disruption of the Aar2p-Prp8p complex in favor of the Brr2p-Prp8p complex. We propose a model in which Aar2p acts as a phosphorylation-controlled U5 snRNP assembly factor that regulates the incorporation of the particle-specific Brr2p. The purpose of this regulation may be to safeguard against nonspecific RNA binding to Prp8p and/or premature activation of Brr2p activity.[Keywords: pre-mRNA splicing; protein interaction; protein phosphorylation; protein structure; spliceosome; yeast] Supplemental material is available for this article. Small ribonucleoproteins (RNPs) are major components of several RNA processing machineries in eukaryotic cells, including spliceosomes, which catalyze the removal of noncoding intervening sequences (introns) from precursor messenger RNAs (pre-mRNAs) and the ligation of the neighboring coding regions (exons) to generate mature mRNA. Canonical small nuclear RNPs (snRNPs), such as the U1, U2, U4, and U5 snRNPs of the major spliceosome, contain a set of seven common Sm proteins bound at a uridine-rich Sm site in the snRNAs, forming the Sm core RNPs (Pomeranz Krummel et al. 2009;Weber et al. 2010). In metazoans, Sm core RNPs are assembled via an elaborate pathway involving nucleo-cytoplasmic shuttling and two multiprotein machineries, the Prmt5 and the SMN complexes (for review, see Kolb et al. 2007;Chari et al. 2009). In addition, each snRNP contains a variable number of particle-specific proteins. The final stages of metazoan snRNP biogenesis are thought to take place in nuclear Cajal bodies, at least in the case of the U2 snRNP (Nesic et al. 2004). However, little is known about how the specific proteins are assembled.Spliceosomes assemble de novo on the substrate premRNAs by stepwise recruitment of the snRNPs and many additional splicing factors that are not stably associated with snRNPs (for review, see Wahl et al. 2009). During the cycle of assembly, activation, catalysis, and disassembly, the spliceosome is repeatedly remodeled with the help of eight conserved RNA-dependent ATPases/RNA helicases and one G-protein (for review, see Staley and Guthrie 1998). Each remodeling step is associated with changes in the macromolecular composition and in the protein-protein, protein-RNA, and RNA-RNA interaction network...

show abstract

AAR2, a gene for splicing pre-mRNA of the MATa1 cistron in cell type control of Saccharomyces cerevisiae.

Abstract: We have isolated a class of mutants, aar2, showing the a mating type due to a defect in al-a2 repression but with a2 repression activity from a nonmater strain of Saccharomyces cerevisiae expressing both a and a mating-type information in duplicate. Cells of the aar2 mutant

Cited by 20 publications

References 32 publications

Targets of the Gal4 Transcription Activator in Functional Transcription Complexes

Targets of the Gal4 Transcription Activator in Functional Transcription Complexes

Structural basis for dual roles of Aar2p in U5 snRNP assembly

Mechanism for Aar2p function as a U5 snRNP assembly factor

Contact Info

Product

Resources

About