A viral transcription factor exhibits antiviral RNA silencing suppression activity independent of its nuclear localization

Abstract

Viral suppressors of RNA silencing (VSRs) are critical for the success of virus infection and efficient accumulation of virus progeny. The chrysanthemum virus B p12 protein acts as a transcription factor to regulate cell size and proliferation favourable for virus infection. Here, we showed that the p12 protein suppressed RNA silencing and was able to complement a VSRdeficient unrelated virus. Moreover, p12 counter-silencing activity could be uncoupled from its function as a transcription factor in the nucleus. The altered p12 protein, which lacked a nuclear localization signal and was not imported into the nucleus, was able to suppress RNA silencing as efficiently as the native protein. The data revealed new aspects of p12 functioning and identified a novel role for this viral zinc-finger transcription factor. The results provided a general insight into one of the activities of the p12 protein, which appeared to possess more than one function.

Translation of the shallot virus X TGB3 gene depends on non-AUG initiation and leaky scanning

“…1a). The latter is structurally related to a small protein encoded by a similarly located gene in viruses of the genus Carlavirus; this carlavirus protein is shown to function as a viral transcription factor and silencing suppressor (Lukhovitskaya et al, 2013(Lukhovitskaya et al, , 2014. While TGB consists of three genes, and three TGB-encoded proteins are required for virus cell-to-cell transport through plasmodesmata (Morozov & Solovyev, 2003;Verchot-Lubicz et al, 2010), the genomes of all allexiviruses including ShVX have been noted to lack an ORF encoding the TGB3 protein.…”

N‐terminal region of cysteine‐rich protein (CRP) in carlaviruses is involved in the determination of symptom types

“…Together with their function as pathogenicity determinants, CRPs of many plant viruses serve as RNA silencing suppressors (RSSs) ( Benyvirus , Chiba et al ., ; Tobravirus , Martin‐Hernández and Baulcombe, ; Furovirus , Sun et al ., ; Hordeivirus , Te et al ., ). RSS activity has also been reported in CRPs of carlaviruses, including SPCFV (Deng et al ., ), CVB (Lukhovitskaya et al ., ), PVH (Li et al ., ) and PVM (Senshu et al ., ). However, the characteristics of these CRPs as RSSs are considerably different.…”

“…First, they have notably different RSS activities; SPCFV CRP possesses strong RSS activity, similar to that of Cucumber mosaic virus (CMV) 2b, a well-known efficient RSS, whereas CRPs of PVM and PVH exhibit weaker RSS activity compared with SPCFV CRP (Deng et al, 2015;Li et al, 2013;Senshu et al, 2011). Second, it is dependent on the carlavirus species as to whether or not the NLS of each CRP is essential for RSS activity; NLS in SPCFV CRP plays a critical role in RSS activity, whereas CVB CRP acts as an RSS independent of its nuclear localization (Deng et al, 2015;Lukhovitskaya et al, 2014). In addition, as mentioned above, the symptoms induced by CRPs of different carlavirus species under heterologous expression by a PVX vector are quite variable (Deng et al, 2015;Li et al, 2013;Lukhovitskaya et al, 2005;Senshu et al, 2011).…”

Phytophthora infestans effector Pi14054 is a novel candidate suppressor of host silencing mechanisms

“…The primers used for cloning Pi14054 were (Fw 5 ' C A C C AT G C G C T G C A AT C A C A C C 3´R v 5'CTAAAAGTCGATTATCGGCTTTTTAC3´). We tested putative RxLR effectors from our collection, (listed in Table S1) along with controls, by syringe infiltrating N. benthamiana leaves with A. tumefaciens delivering genes encoding candidate silencing suppressors under control of the 35S promotor from Cauliflower Mosaic Virus (CaMV) (Lukhovitskaya et al 2014). After 24 h, the pre-infiltrated leaves were mechanically rub-inoculated with TCV-sGFP infectious RNA transcripts (Powers et al 2008a, b).…”

“…With the aim of identifying additional suppressors of silencing in P. infestans, we have tested a number of putative effectors in our collection (Table S1) using a reporter assay based on the Turnip crinkle virus -green fluorescent protein (TCV-sGFP) system (Powers et al 2008a, b;Lukhovitskaya et al 2014). This is a newly established, novel way to identify RNA silencing suppressors that are not detected by other assays either due to the mode of action of the suppressor, or suppression strength (Powers et al 2008a, b;Lukhovitskaya et al 2013).…”