A variant form of ETS1 induces apoptosis in human colon cancer cells

Huang, Chengcheng; Papas, Takis S.; Bhat, Narayan K.

doi:10.1038/sj.onc.1201408

Cited by 35 publications

(36 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For example, both cMyc and c-fos which are immediate early gene products have been shown to induce apoptosis (Canman and Kastan, 1995;Preston et al, 1996). The gag-Myb-Ets fusion protein, c-ets-1 proto-oncogene, and two ets superfamily members namely erg and¯i-1 have been shown to inhibit apoptosis whereas ets-1 splice variant has been shown to induce apoptosis indicating a role for the ets family of genes in apoptosis (Athanasiou et al, 1996;Bories et al, 1995;Muthusamy et al, 1995;Yi et al, 1997;Huang et al, 1997). Our ®ndings on the Elk-1 proteins is consistent with a role for the ets related genes in cell death.…”

supporting

confidence: 83%

“…Similarly the Ets-1 proto-oncogene was shown to be required for the normal survival and activation of B and T cells while an Ets-1 splice variant was shown to induce apoptosis in human colon cancer cells indicating a role in apoptosis (Bories et al, 1995;Muthusamy et al, 1995;Huang et al, 1997). Recently, erg and¯i-1 proteins were shown to inhibit apoptosis (Yi et al, 1997).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Induction of apoptosis by Elk-1 and ΔElk-1 proteins

et al. 1998

View full text Add to dashboard Cite

Elk-1, an ets related gene codes for at least two splice variants Elk-1, which regulates c-fos transcription and DElk-1, both of which function as transcriptional activators. To investigate the role of Elk-1 and DElk-1 proteins in apoptosis; we have developed rat ®broblast cell lines and human breast cancer cell lines expressing Elk-1 and DElk-1. The expression of Elk-1 and DElk-1 proteins in the Elk-1/DElk-1 transfectants were analysed by immuno¯uorescence, immunohistochemistry, and Western blot analysis. The Elk-1 unlike DElk-1 transfectants showed a shortened and¯attened morphology compared to the parental cells. We have found that calcium ionophore treatment of Rat-1 Elk-1, MCF-7 Elk-1, Rat-1 DElk-1 and MCF-7 DElk-1 transfectants resulted in programmed cell death. These results indicate that constitutive expression of Elk-1 and DElk-1 proteins triggers apoptosis in Rat-1 ®broblasts and breast cancer cells when treated with calcium ionophore.Keywords: Elk-1; DElk-1; apoptosis; calcium ionophore; breast cancer; MCF-7; Rat-1The Elk-1 gene belongs to the ets family of ternary complex factors (TCFs), i.e. Elk-1, SAP1, and NET/ ERP/SAP2/Elk-3 (Rao et al., 1989;Hipskind et al., 1991;Giovane et al., 1994;Lopez et al., 1994;Dalton and Treisman, 1992;Price et al., 1995;Nozaki et al., 1996). The Elk-1 gene codes for at least two alternately spliced products Elk-1 (Rao et al., 1989) and DElk-1 (Rao and Reddy, 1993) which function as transcriptional activators (Rao and Reddy, 1992;Bhattacharya et al., 1993), are substrates for MAP kinases Marias et al., 1993;Hill et al., 1993) and JNK protein kinases (Gupta et al., 1996;Whitmarsh et al., 1995). As mentioned earlier, the Elk-1 protein is a TCF which in association with serum response factor (SRF) forms a ternary complex on the serum response element (SRE) of the c-fos promoter and regulates cfos transcription (Hipskind et al., 1991). The TCF's which includes Elk-1 have three domains with similar sequences and functions. The ets domain mediates DNA binding, the SRF interaction domain interacts with SRF to form a ternary complex with the c-fos SRE and the C-terminal domain activates transcription upon phosphorylation by MAP kinases (Rao et al., 1989;Rao and Reddy, 1992;Dalton and Treisman, 1992;Janknecht et al., 1993Janknecht et al., , 1994Marias et al., 1993;Giovane et al., 1994;Hipskind et al., 1994;Kortenjann et al., 1994;Lopez et al., 1994;Hill et al., 1995;Price et al., 1995;Whitmarsh et al., 1995) and JNK kinases (Gupta et al., 1996). Thus Elk-1 represents a key link between signal transduction and induction of gene transcription.The Gag-Myb-Ets fusion protein, identi®ed in the avian acute leukemia virus E26 was shown to inhibit apoptosis and induce erythroid di erentiation in hematopoietic cells (Athanasiou et al., 1996). Similarly the Ets-1 proto-oncogene was shown to be required for the normal survival and activation of B and T cells while an Ets-1 splice variant was shown to induce apoptosis in human colon cancer cells indicating a role in apoptosis (Bories et al....

show abstract

supporting

confidence: 83%

mentioning

confidence: 99%

Induction of apoptosis by Elk-1 and ΔElk-1 proteins

et al. 1998

View full text Add to dashboard Cite

show abstract

“…Interestingly, ETS proteins play a role in regulating genes involved in both cell cycle progression and programmed cell death including cdc2, jun B, c-fos, c-myc, Rb, p53 and bcl-2 (reviewed in Bassuk and Leiden, 1997). In addition, the function of ETS1 in the regulation of apoptosis has been recently demonstrated in lymphoid (Bories et al, 1995) and colon cancer cells (Huang et al, 1997).…”

Section: Inhibition Of Ets1 Expression Enhances Growth Retardation Ofmentioning

confidence: 99%

Regulation of the human poly(ADP-ribose) polymerase promoter by the ETS transcription factor

et al. 1999

View full text Add to dashboard Cite

Ewing's sarcoma (EWS) cells accumulate elevated steady-state levels of poly (ADP-ribose) polymerase (PARP) mRNA and protein. To understand the molecular mechanisms underlying PARP upregulation, we cloned and analysed the 5'-¯anking region of the PARP gene from EWS cells. Nucleotide sequence analysis demonstrated no variations in the PARP promoter region in EWS cells. The PARP promoter encompasses multiple binding motifs for the ETS transcription factor. We have also observed that there is a coordinated up-regulation of the expression of both PARP and ETS1, relative to cells of other human tumor types expressing lower levels of PARP. Transient coexpression of ETS1 in EWS cells resulted in a strong enhancement of PARP-promoter activity. The participation of ETS in the regulation of PARP gene expression was further demonstrated in EWS cells stably transfected with Ets1 antisense cDNA constructs. Antisensemediated down-regulation of endogenous ETS1 resulted in the inhibition of PARP expression in EWS cells, and sensitized these cells to ionizing radiation. These data provide support for ETS regulation of PARP expression levels, and implicate ETS transcription factors in the radiation response of EWS cells.

show abstract

“…TTAAGCGCTATGGCAGGTGGGG GCGGCG SP100 3 0 HindIII (no stop codon) GCAAAGCTTATCTTCTTTACCTG ACCCTCTTC pSG5-p51-ETS1 and pSG5-p42-ETS1 have been previously described (Huang et al, 1997). pGL3-MMP1-2G, pGL3-MMP1-1G (Rutter et al, 1998), MMP1-517/ þ 63-coll-luciferase (Schneikert et al, 1996) and pGL2-uPA (pPR99, which contains the 90 bp fragment (À2446 to À2356) fused to the uPA proximal promoter (À114 to þ 398) (Rorth et al, 1990;Stacey et al, 1995) were used as reporter genes in the transient transfection assays.…”

Section: Plasmid Constructionmentioning

confidence: 99%

SP100 expression modulates ETS1 transcriptional activity and inhibits cell invasion

Yordy

Sementchenko

et al. 2004

Oncogene

View full text Add to dashboard Cite

The ETS1 transcription factor is a member of the Ets family of conserved sequence-specific DNA-binding proteins. ETS1 has been shown to play important roles in various cellular processes such as proliferation, differentiation, lymphoid development, motility, invasion and angiogenesis. These diverse roles of ETS1 are likely to be dependent on specific protein interactions. To identify proteins that interact with ETS1, a yeast two-hybrid screen was conducted. Here, we describe the functional interaction between SP100 and ETS1. SP100 protein interacts with ETS1 both in vitro and in vivo. SP100 is localized to nuclear bodies and ETS1 expression alters the nuclear body morphology in living cells. SP100 negatively modulates ETS1 transcriptional activation of the MMP1 and uPA promoters in a dose-dependent manner, decreases the expression of these endogenous genes, and reduces ETS1 DNA binding. Expression of SP100 inhibits the invasion of breast cancer cells and is induced by Interferon-a, which has been shown to inhibit the invasion of cancer cells. These data demonstrate that SP100 modulates ETS1-dependent biological processes.

show abstract

A variant form of ETS1 induces apoptosis in human colon cancer cells

Cited by 35 publications

References 9 publications

Induction of apoptosis by Elk-1 and ΔElk-1 proteins

Induction of apoptosis by Elk-1 and ΔElk-1 proteins

Regulation of the human poly(ADP-ribose) polymerase promoter by the ETS transcription factor

SP100 expression modulates ETS1 transcriptional activity and inhibits cell invasion

Contact Info

Product

Resources

About