A Vaccine Based on a Modified Vaccinia Virus Ankara Vector Expressing Zika Virus Structural Proteins Controls Zika Virus Replication in Mice

Abstract

Zika virus (ZIKV) is a re-emerging mosquito-borne flavivirus that affects humans and can cause severe neurological complications, including Guillain-Barré syndrome and microcephaly. Since 2007 there have been three large outbreaks; the last and larger spread in the Americas in 2015. Actually, ZIKV is circulating in the Americas, Southeast Asia, and the Pacific Islands, and represents a potential pandemic threat. Given the rapid ZIKV dissemination and the severe neurological and teratogenic sequelae associated with ZIKV infection, the development of a safe and efficacious vaccine is critical. In this study, we have developed and characterized the immunogenicity and efficacy of a novel ZIKV vaccine based on the highly attenuated poxvirus vector modified vaccinia virus Ankara (MVA) expressing the ZIKV prM and E structural genes (termed MVA-ZIKV). MVA-ZIKV expressed efficiently the ZIKV structural proteins, assembled in virus-like particles (VLPs) and was genetically stable upon nine passages in cell culture. Immunization of mice with MVA-ZIKV elicited antibodies that were able to neutralize ZIKV and induced potent and polyfunctional ZIKV-specific CD8+ T cell responses that were mainly of an effector memory phenotype. Moreover, a single dose of MVA-ZIKV reduced significantly the viremia in susceptible immunocompromised mice challenged with live ZIKV. These findings support the use of MVA-ZIKV as a potential vaccine against ZIKV.

Assessment of Immunogenicity and Efficacy of a Zika Vaccine Using Modified Vaccinia Ankara Virus as Carriers

“…MVA-ZIKV vaccine candidates induced modest levels of anti-ZIKV E antibodies after a single vaccination approach and they failed to confer sterile protection. This observation agrees with Perez et al, in which a single immunisation of MVA-ZIKV induced a 2.5 log reduction in viraemia, whereas a two-dose immunisation further decreased the viral load but no sterile protection was achieved [21]. These data highlight the following considerations.…”

“…The rationale behind constructing MVA vectored-ZIKV vaccines relies in the proven safety in clinical trials and its high immunogenicity demonstrated in various vaccine developments. Furthermore, Pérez et al constructed an MVA-ZIKV vaccine expressing the prME gene, which is capable of expressing Virus-Like Particles (VLPs) and inducing partial protection in mice after a ZIKV challenge, upon a homologous prime-boost approach [21]. Of particular interest, an MVA vaccine expressing the non-structural protein 1 (NS1) of ZIKV has been demonstrated to be 100% effective in both a single-or two-dose vaccination [22].…”

An MVA Vector Expressing HIV-1 Envelope under the Control of a Potent Vaccinia Virus Promoter as a Promising Strategy in HIV/AIDS Vaccine Design

“…The MVA-LEO160-gp120 recombinant virus was generated using MVA-WT as parental virus, and pLZAW1-LEO160-gp120 as plasmid transfer vector; employing an infection/transfection protocol previously described [34][35][36][37][38][39]. After the infection/transfection in DF-1 cells, we initially selected blue plaques stained with 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-Gal, Sigma-Aldrich, St. Louis, MO, USA).…”

“…To verify that the HIV-1 gp120 sequence under the control of the novel synthetic VACV LEO160 promoter was correctly inserted in MVA-LEO160-gp120, viral DNA was extracted from DF-1 cells mock infected or infected at 5 plaque forming units (PFU)/cell with the different viruses, as previously described [34], and the correct insertion was confirmed by PCR analysis. Primers TK-L (TGATTAGTTTGATGCGATTC) and TK-R (TGTCCTTGATACGGCAG) spanning the MVA TK locus, were used for PCR analysis, to verify the correct insertion of the LEO160-gp120 sequence in MVA-LEO160-gp120.…”

“…The genetic stability of recombinant MVA-LEO160-gp120 was analyzed as previously described [34,40]. MVA-LEO160-gp120 (P2 stock) was continuously grown at low multiplicity of infection (MOI) in DF-1 cells during 9 passages and then 28 individual plaques were picked from virus derived from passage 9.…”