A teat papillomatosis case in a Damascus goat (Shami goat) in Hatay province, Turkey: a new putative papillomavirus?

Abstract

Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.

The diagnostic value of the droplet digital PCR for the detection of bovine deltapapillomavirus in goats by liquid biopsy

“…As such, ddPCR can detect clinically relevant changes in viral load appropriate prophylactic and/or therapeutic tool, as well as to determine the interspecies transmission potential and evolution of BPVs, the BPV prevalence, distribution and clinical consequences must be identified in different animal species (Dogan et al, 2018). We believe that this type of study is remarkable for bovine δPVs, which are the only BPVs responsible for cross-species transfection and infection (IARC, 2007).…”

Genomic and phylogenetic characterization of ChPV2, a novel goat PV closely related to the Xi-PV1 species infecting bovines

“…To isolate the complete genomic DNA of a PV identified in DNA samples from teat papillomas of a Damascus goat in Turkey [ 12 ], we performed long range PCR using a primer set directed towards the boarders of the previously published, partial L1 -nucleotide sequence (MG523274, HTY-goat-TR2016). The resulting PCR-product was cloned and sequenced by primer walking.…”

“…Origin of animal samples [ 12 ] and DNA extraction [ 13 ] were described before. The host animal was a Damascus goat (Shami goat) in a herd comprising about 60 animals in Hatay province in southern Turkey.…”

“…Based on the previously published, partial L1 -nucleotide sequence (MG523274, HTY-goat-TR2016) [ 12 ], we designed primers (5′GACTGCCCTCCTTTACAGCTT3′ and 5′GCTTTCCTGAACTTGGTAGCC3′) directed towards the edges of this fragment. The remaining part of the PV genome was amplified using Phusion DNA Polymerase kit using with standard buffer (New England Biolabs) and 100 ng of the original sample DNA as template.…”

“…PVs infecting ruminants belong within the Delta- , Xi- , Epsilon- , Dyoxi, Dyokappa-, Phi- and DyolambdaPV genera within the Beta-XiPV and Delta-ZetaPV crown groups. In this manuscript we have focused on the description of a novel PV, Capra hircus papillomavirus 2 (ChPV2), previously identified in teat-papillomas of a Damascus goat in Turkey [ 12 ]. A previously described goat PV, Capra hircus papillomavirus 1 (ChPV1) [ 11 ] was classified as the only member of the Phipapillomavirus, sister taxon of a RtPV1 infecting Timor deer, and closely related to Xipapillomavirus.…”