A taxonomic and phylogenetic revision of the Penicillium sclerotiorum complex

Abstract

The morphological concept of Penicillium sclerotiorum (subgenus Aspergilloides) includes strains with monoverticillate, vesiculate conidiophores, and vivid orange to red colony colours, with colourful sclerotia sometimes produced. Multigene phylogenetic analyses with the nuclear ribosomal internal transcribed spacer (ITS) region, cytochrome c oxidase subunit 1 (cox1), β-tubulin (benA), translation elongation factor 1-α (tef1-α), and calmodulin (cmd), reveal that the P. sclerotiorum morphospecies is a complex of seven phylogenetically distinct species, three of which were recently described, namely P. guanacastense, P. mallochii, and P. viticola. Three previously unidentified species are described here as P. cainii, P. jacksonii, and P. johnkrugii. The phylogenetic species are morphologically similar, but differ in combinations of colony characters, sclerotium production, conidiophore stipe roughening and branching, and conidial shape. Ecological characters and differences in geographical distribution further characterise some of the species, but increased sampling is necessary to confirm these differences. The fungal DNA barcode, the ITS, and the animal DNA barcode, cox1, have lower species resolving ability in our phylogenetic analyses, but still allow identification of all the species. Tef1-α and cmd were superior in providing fully resolved, statistically well-supported phylogenetic trees for this species complex, whereas benA resolved all species but had some issues with paraphyly. Penicillium adametzioides and P. multicolor, considered synonyms of P. sclerotiorum by some previous authors, do not belong to the P. sclerotiorum complex.Taxonomic novelties:New species: Penicillium cainii K.G. Rivera, Malloch & Seifert, P. jacksonii K.G. Rivera, Houbraken & Seifert, P. johnkrugii K.G. Rivera, Houbraken & Seifert.

Taxonomy and Antifungal Susceptibility of Clinically Important Rasamsonia Species

“…The limited reports of detection of this species in clinical samples might also be due to its resemblance to Paecilomyces variotii, and misidentifications have been reported (6,11). In the last decade, new insights have determined that certain well-known species appear to be species complexes (22)(23)(24). In line with those taxonomic studies, we show that Rasamsonia argillacea is a species complex consisting of at least four species.…”

A study on biological activity of marine fungi from different habitats in coastal regions

“…The chromosomal DNA from all strains were extracted using a fungus genomic DNA extraction kit (Tiangen Co., China), and the isolated DNA was amplified by PCR using universal primers ITS 1 and ITS 4 (Rivera and Seifert 2011), corresponding to a 5.8S rDNA sequence. For PCR, the reaction elements included 1 μL of the template DNA, 5 μL of 10× Taq buffer, 1 μL of 10 mM mixed dNTP, 1 μL of sense-ITS 1 primer (TCCGTAGGTGAACCTGCGG, 10 pmol/μL), 1 μL of antisense-ITS 4 primer (TCCTCCGCTTATTGATATGC, 10 pmol/μL), and 5 U of Taq DNA polymerase, which were prepared in a final volume of 50 μL.…”

Genome Sequencing and Analysis of the Filamentous Fungus Penicillium sclerotiorum 113, Isolated after Hurricane Sandy

“…It has subsequently been isolated from Africa, Asia, and North America (2, 3). The fungus usually produces distinctive bright orange pigments, some of which have been identified as carotenoids (4).…”