A survey of Western Australian sheep, cattle and kangaroos to determine the prevalence of Coxiella burnetii

Banazis, Michael; Bestall, Abbey Simone; Reid, Simon; Fenwick, Stan

doi:10.1016/j.vetmic.2009.12.002

Cited by 45 publications

(66 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the present study, we used the indirect ELISA CHEKIT Q fever test to screen antibodies to C. burnetii among indigenous livestock in Saudi Arabia. The same test has been widely used for Q fever surveys in various species of ruminant farm animals and wild ungulates [16], as well as kangaroos [22] and even humans [23].…”

Section: Discussionmentioning

confidence: 99%

Seroprevalence of Q fever in farm animals in Saudi Arabia

Jarelnabi¹,

Alshaikh²,

Bakhiet³

et al. 2018

biomedicalresearch

View full text Add to dashboard Cite

This study was undertaken to determine the seroprevalence of Q fever in domestic livestock in Saudi Arabia. Serum samples from 489 camels, 428 cattle, 630 sheep and 423 goats, of either sex, from different localities were tested for antibodies against C. burnetii using a Q fever indirect enzyme-linked immunosorbent assay (ELISA). A subsample of 307 animals of different species was simultaneously tested for C. burnetii antibodies by ELISA and indirect immunofluorescence (IFA). The overall seroprevalence was 30.71%. Prevalence by species was 51.53%, 30.67%, 34.04% and 12.38% in camels, cattle, goats and sheep, respectively. Significant differences in seroprevalence were recorded between species and locations. The prevalence was overtly higher in adult as compared to young animals. No significant difference was recorded between male and female animals. There was a close agreement between ELISA and IFA results in cattle and camels while the results of the two tests were at variance in sheep and goats. The results indicate that the domestic livestock and the camel are the source of Q fever endemicity in Saudi Arabia.

show abstract

Section: Discussionmentioning

confidence: 99%

Seroprevalence of Q fever in farm animals in Saudi Arabia

Jarelnabi¹,

Alshaikh²,

Bakhiet³

et al. 2018

biomedicalresearch

View full text Add to dashboard Cite

show abstract

“…A Coxiella burnetii specific qPCR assay targeting the IS1111a transposase gene (IS1111aF 5" GTTTCATCCGCGGTGTTAAT; IS1111aR 5"TGCAAGAATACGGACTCACG; probe IS1111aP 5" CCCACCGCTTCGCTCGCTAA) (Banazis et al, 2010) …”

Section: Real-time Pcrmentioning

confidence: 99%

Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia

Oskam

Gofton

Greay

et al. 2017

Veterinary Microbiology

View full text Add to dashboard Cite

Molecular investigation into the presence of a Coxiella sp.in Rhipicephalus sanguineus ticks in Australia.Veterinary Microbiology http://dx.doi.org/10. 1016/j.vetmic.2017.01.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. turanicus ticks overseas. This study illustrates the value of using genus specific PCR assays to detect previously unreported bacterial species. Furthermore, the presence of an additional Coxiella sp. in Australia requires further investigation into its potential for contributing to serological crossreactions during Q fever testing.

show abstract

“…Wild dogs in Northern Queensland have been shown to be seropositive to C. burnetii (Cooper et al, 2012). Considering the contact rates between wild dogs and potentially Q fever infected wildlife such as flying foxes and koalas (Tozer et al, 2014), kangaroos (Banazis et al, 2010), brush tail possums (Cooper et al, 2012) and bandicoots (Bennett et al, 2011;Cooper et al, 2012) are likely to be frequent, there is a strong potential for C. burnetii to be present in the peri-urban wild dog population. This may provide an additional source of infection for domestic dogs, and resultant links to human infection, but also provide a direct link between peri-urban wild dogs and human disease.…”

Section: Coxiella Burnetiimentioning

confidence: 99%

Prevalence, risk factors, and geographical distribution of zoonotic pathogens carried by peri-urban wild dogs

Harriott¹

View full text Add to dashboard Cite

Established wildlife populations within peri-urban and urban environments provide an opportunity for the spread of zoonotic pathogens to and from human-associated environments. Wild dogs, including dingoes (Canis lupus dingo), feral domestic dogs (Canis lupus familiaris), and their cross breeds (hybrids) are common across the Australian mainland, and hybrid populations are particularly frequent within peri-urban environments. Previous studies have shown that wild dogs carry zoonotic pathogens of public health significance, however, data relating to peri-urban wild dogs has been limited to a few studies with a small geographical range and / or small sample size.To address the potential public health implications of peri-urban wild dogs, information regarding pathogen diversity, prevalence, risk factors and geographical distribution are required.To investigate the diversity and prevalence of zoonotic pathogens in peri-urban wild dogs, a cross sectional survey was undertaken. Utilising council management programs and private trappers, 201 wild dogs were collected for necropsy. Analysis of faecal and blood samples indicated that helminth parasites were common, detected within 79.6  5.4 % of wild dogs tested, however bacterial pathogens were much less prevalent. Echinococcus granulosus was the most prevalent parasite detected by necropsy, (prevalence 50.7  6.9 %). Hookworms were found to comprise the second most common pathogen of zoonotic significance with an overall prevalence of 28.8% ( 7.1%).Molecular characterisation identified the majority as Ancylostoma caninum. Several pathogens of zoonotic interest were not detected during the study, namely Brucella suis and Neospora caninum.This study provided essential baseline data on the prevalence of pathogens carried by peri-urban wild dog populations in north-eastern Australia, which is required to inform the management of wild dogs in peri-urban areas.Characteristics of the most prevalent parasitic pathogens and their lifecycles suggested possible associations between the diet composition of wild dogs and their infection status. Whole stomachs were collected during necropsy and analysed for dietary composition and biomass. The majority of food items detected were mammalian prey species, most commonly: swamp wallaby (20.6  6.08%); canine species (prey) (10.6  4.62%); eastern grey kangaroo (10.0  4.51 %); and deer species (10.0  4.51%). Wild dogs that consumed swamp wallaby (OR 1.79, p<0.05) or unidentified species of macropods (OR 4.18, p<0.01) were found to be significantly more likely to be infected with E. granulosus than dogs who had consumed non-macropod species. Wild dogs that had consumed various bird (OR 7.80, p<0.01) or bandicoot species (OR 3.09, p<0.01) were found to be significantly more likely to be infected with hookworm compared to dogs that had consumed ii macropods. These findings suggest that diet composition is an important contributing factor to the infection status of wild dogs.To explore the geographical distribution of pathogens a...

show abstract

A survey of Western Australian sheep, cattle and kangaroos to determine the prevalence of Coxiella burnetii

Cited by 45 publications

References 27 publications

Seroprevalence of Q fever in farm animals in Saudi Arabia

Seroprevalence of Q fever in farm animals in Saudi Arabia

Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia

Prevalence, risk factors, and geographical distribution of zoonotic pathogens carried by peri-urban wild dogs

Contact Info

Product

Resources

About