A stable but reversible integrated surrogate reporter for assaying CRISPR/Cas9-stimulated homology-directed repair

Wen, Yahong; Liao, Grace; Pritchard, Thomas; Zhao, Tingting; Connelly, Jon P.; Pruett-Miller, Shondra M.; Blanc, Valérie; Davidson, Nicholas O.; Madison, Blair B.

doi:10.1074/jbc.m117.777722

Cited by 14 publications

(21 citation statements)

References 61 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, we found no significant changes in serum or hepatic TG or cholesterol content and no change in VLDL secretion or in serum or hepatic APOB content or isoform distribution in A1cf -/mice (Supplemental Figure 2A-D). We generated two independent lines of HepG2 CRISPR-deleted A1CF null cells (17), which revealed ~30% decrease in both APOB synthesis and secretion (Supplemental Figure 2E, F). Taken together, these findings suggest that loss of A1CF slightly decreases APOB production in HepG2 cells but does not alter APOB expression or VLDL secretion in mouse liver.…”

Section: A1cf +/Tg Mice Exhibit Increased Hepatocyte Proliferation Anmentioning

confidence: 99%

Apobec1 complementation factor overexpression promotes hepatic steatosis, fibrosis, and hepatocellular cancer

Blanc¹,

Riordan²,

Soleyman-Jahi³

et al. 2021

Journal of Clinical Investigation

Self Cite

View full text Add to dashboard Cite

RNA binding protein Apobec1 Complementation Factor (A1CF) regulates posttranscriptional ApoB mRNA editing but the range of RNA targets and long-term impact of altered A1CF expression on liver function are unknown. Here we studied hepatocyte-specific A1cf transgenic (A1cf +/Tg), A1cf +/Tg Apobec1-/and A1cf-/mice fed chow or high fat/high fructose diets using RNA-Seq, RNA-CLIP Seq and tissue microarrays from human hepatocellular cancer (HCC). A1cf +/Tg mice exhibited increased hepatic proliferation and steatosis, with increased lipogenic gene expression (Mogat1, Mogat2, Cidea, Cd36) associated with shifts in polysomal RNA distribution. Aged A1cf +/Tg mice developed spontaneous fibrosis, dysplasia and HCC, which was accelerated on a high fat/fructose diet and independent of Apobec1. RNA-Seq revealed increased expression of mRNAs involved in oxidative stress (Gstm3, Gpx3, Cbr3), inflammatory response (Il19, Cxcl14, Tnfa, Ly6c), extracellular matrix organization (Mmp2, Col1a1, Col4a1), proliferation (Kif20a, Mcm2, Mcm4, Mcm6) with a subset of mRNAs (including Sox4, Sox9, Cdh1) identified in RNA CLIP-Seq. Increased A1CF expression in human HCC correlated with advanced fibrosis and with reduced survival in a subset with nonalcoholic fatty liver disease. In conclusion, we show that hepatic A1CF overexpression selectively alters polysomal distribution and mRNA expression, promoting lipogenic, proliferative and inflammatory pathways leading to HCC.

show abstract

Section: A1cf +/Tg Mice Exhibit Increased Hepatocyte Proliferation Anmentioning

confidence: 99%

Apobec1 complementation factor overexpression promotes hepatic steatosis, fibrosis, and hepatocellular cancer

Blanc¹,

Riordan²,

Soleyman-Jahi³

et al. 2021

Journal of Clinical Investigation

Self Cite

View full text Add to dashboard Cite

show abstract

“…B) Colorectal cancer cell lines (N=154 from [37]) were parsed into bottom and top quintiles for PLAGL2 expression and then evaluated for ASCL2 mRNA expression. C) EspCas9-mediated mutagenesis using SRIRACCHA [32] and gRNAs directed against LacZ or PLAGL2 , followed by selection with hygromycin and RT-PCR for ASCL2 mRNA. D) Depiction of the STAR ASCL2 reporter construct.…”

Section: Resultsmentioning

confidence: 99%

“…5J), suggesting a role for both target genes. To examine a more diverse array of PLAGL2 mutants, we performed SRIRACCHA-mediated mutagenesis [32] in Caco2 CRC cell lines while simultaneously providing PB-mediated transgenic expression of either IGF2 or ASCL2. If either IGF2 or ASCL2 is able to compensate for loss of PLAGL2, then we would expect increased survival and growth of clones with PLAGL2 loss-of-function mutations if such clones also express exogenous IGF2 or ASCL2.…”

Section: Resultsmentioning

confidence: 99%

“…SW480 (8×10^5 cells) or Caco2 (3×10^5 cell) were plated in triplicate or quadruplicate in 6-well plates 24 hours prior to transfection. For one-step transfection with SRIRACCHA components, 600 ng of the BII-gR-PtW-eSpCas9 vector with gRNAs specific for either PLAGL2 (GTTCACCGCAAGGACCATCTG) or LacZ (GAAGGCGGCGGGCCATTACC) were transfected along with 600 ng of the BII-C3H target vector [32] containing target sequences either for PLAGL2 or LacZ cloned at the 3’ end of the PAC ORF, 500 ng of pBS-PtH, and 300 ng of pCMV-hyPBase. SW480 cells were transfected using JetPrime (Polyplus Inc.) (2 μL/μg DNA) per manufacturer instructions while Caco2 cells were transfected using Lipofectamine 2000 (ThermoFisher Inc.) (4 μL/μg DNA) per manufacturer instructions.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The oncogenic function of PLAGL2 is mediated via specific target genes through a Wnt-independent mechanism in colorectal cancer

Fischer

Veronese-Paniagua

Swaminathan

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Colorectal cancer (CRC) tumorigenesis and progression are linked to common oncogenic mutations, especially in the tumor suppressor APC, whose loss triggers the deregulation of TCF4/β-Catenin activity. CRC tumorigenesis is also driven by multiple epi-mutational modifiers, such as transcriptional regulators. We describe the common (and near-universal) activation of the zinc finger transcription factor and Let-7 target PLAGL2 in CRC and find that it is a key driver of intestinal epithelial transformation. PLAGL2 drives proliferation, cell cycle progression, and anchorage-independent growth in CRC cell lines and non-transformed intestinal cells. Investigating effects of PLAGL2 on downstream pathways revealed very modest effects on canonical Wnt signaling. Alternatively, we find pronounced effects on the direct PLAGL2 target genes IGF2, a fetal growth factor, and ASCL2, an intestinal stem cell-specific bHLH transcription factor. Inactivation of PLAGL2 in CRC cell lines has pronounced effects on ASCL2 reporter activity. Furthermore, ASCL2 expression can partially rescue deficits of proliferation and cell cycle progression caused by depletion of PLAGL2 in CRC cell lines. Thus, the oncogenic effects of PLAGL2 appear to be mediated via core stem cell and onco-fetal pathways, with minimal effects on downstream Wnt signaling.

show abstract

“…Matrigel) and are provided with medium containing 3 necessary protein factors, Wnt3a, R spondin 1, 2, or 3, and Noggin (Sato et al, 2009). These factors can be delivered as recombinant proteins or via conditioned medium (CM) from other cell lines engineered to secrete these proteins individually or in combination (Sato et al, 2009; Heijmans et al, 2013; Miyoshi and Stappenbeck, 2013; Ootani et al, 2009; Wen et al, 2017; Wang et al, 2013). Media composition and the delivery method of stem cell niche factors can alter the cellular composition and behavior of the cultured epithelial cells in downstream assays.…”

Section: Introductionmentioning

confidence: 99%

L-WRN conditioned medium for gastrointestinal epithelial stem cell culture shows replicable batch-to-batch activity levels across multiple research teams

2019

View full text Add to dashboard Cite

Conditioned medium (CM) derived from engineered cells often facilitates the cost-effective culture of a variety of stem cells. Growing emphasis on the importance of rigor and reproducibility in lab-based science requires development of best practices approaches, including quality control procedures for the assessment of CM batches to ensure reliable interpretation and reproducibility. Here, we tested activity level variations of L-WRN CM, which is produced from an L cell line engineered to secrete W nt3a, R spondin 3, and N oggin into a single CM that is widely used for gastrointestinal stem cell culture. We assessed 14 independent batches of L-WRN CM, produced by 5 laboratories at 3 research institutions, by multiple quantitative assays. We observed highly replicable activity levels among L-WRN CM batches prepared according to a previously published protocol. Quality control assays measuring spheroid growth or mRNA gene marker expression were best able to distinguish the quality L-WRN CM batches, whereas a Wnt reporter assay did not. Thus, we have validated that L-WRN CM activity is highly reproducible over time and between laboratories and have provided guidelines for L-WRN CM quality control testing. These validation procedures and guidelines will benefit experiment replication efforts in stem cell research.

show abstract

A stable but reversible integrated surrogate reporter for assaying CRISPR/Cas9-stimulated homology-directed repair

Abstract: "A stable but reversible integrated surrogate reporter for assaying CRISPR/Cas9-stimulated homology-directed repair

Cited by 14 publications

References 61 publications

Apobec1 complementation factor overexpression promotes hepatic steatosis, fibrosis, and hepatocellular cancer

Apobec1 complementation factor overexpression promotes hepatic steatosis, fibrosis, and hepatocellular cancer

The oncogenic function of PLAGL2 is mediated via specific target genes through a Wnt-independent mechanism in colorectal cancer

L-WRN conditioned medium for gastrointestinal epithelial stem cell culture shows replicable batch-to-batch activity levels across multiple research teams

Contact Info

Product

Resources

About