A specific N-terminal extension of the 8 kDa domain is required for DNA end-bridging by human Polµ and Polλ

Abstract

Human DNA polymerases mu (Polµ) and lambda (Polλ) are X family members involved in the repair of double-strand breaks in DNA during non-homologous end joining. Crucial abilities of these enzymes include bridging of the two 3′ single-stranded overhangs and trans-polymerization using one 3′ end as primer and the other as template, to minimize sequence loss. In this context, we have studied the importance of a previously uncharacterised sequence (‘brooch’), located at the N-terminal boundary of the Polß-like polymerase core, and formed by Tyr141, Ala142, Cys143, Gln144 and Arg145 in Polµ, and by Trp239, Val240, Cys241, Ala242 and Gln243 in Polλ. The brooch is potentially implicated in the maintenance of a closed conformation throughout the catalytic cycle, and our studies indicate that it could be a target of Cdk phosphorylation in Polµ. The brooch is irrelevant for 1 nt gap filling, but of specific importance during end joining: single mutations in the conserved residues reduced the formation of two ended synapses and strongly diminished the ability of Polµ and polymerase lambda to perform non-homologous end joining reactions in vitro.

Structural basis for a novel mechanism of DNA bridging and alignment in eukaryotic DSB DNA repair

“…The 5′‐end nucleo‐base of the downstream primer strand is stacked under the 186–187 peptide bond, with a characteristic distance of 3.4 Å between them (not shown). Interestingly, the N‐terminus of the 8 kDa domain, recently shown to be important for DNA end‐bridging in Pol mu (Martin et al , ), contains residues interacting with the in trans DNA duplex involving Q152 and Y153 in Tdt (positions 140–141 in Pol mu) and a DNA phosphate (Fig D). Analysis of crystal packing reveals that the downstream DNA duplex forms a continuous double helix (10 bp long) with another DNA duplex molecule in the crystal lattice.…”

Regulation of human polλ by ATM-mediated phosphorylation during non-homologous end joining

“…Silencing of endogenous POLL was performed by using previously validated siRNAs [27] and two consecutive rounds of transfection with RNAiMAX according to manufacturer's protocol (Life Technologies). To obtain human POLL mutant versions (both T204A phospho-blocking and T204E phospho-mimetic mutants) for protein purification, site-directed mutagenesis was performed using the plasmid pET22b-Polλ [28] as a template with the same oligonucleotides T204A-s and T204A-as described above, and oligonucleotides T204E-s (5′-GATGATGAAGCCAGTGATGGGGAAGAAGAGCAGGTTAGTGCAGCTGATCTGGAAGCC-3′) and T204E-as (5′-GGCTTCCAGATCAGCTGCACTAACCTGCTCTTCTTCCCCATCACTGGCT TCATCATC-3′), respectively. All constructs were verified by DNA sequencing.…”

“…Recombinant wild-type Polλ and phospho-blocking mutants (T204A, T188A T188,204A) were over-expressed in E. coli BL21-pRIL and purified as previously described [28]. One microgram of purified proteins was used in kinase assays in vitro with either 20 units of human DNA-PK complex (Promega) or immunoprecipitated ATM.…”

“…Recombinant wild-type Polλ, phospho-blocking (T204A) and phospho-mimic (T204E) mutants were over-expressed in E. coli and purified as previously described [28]. Oligonucleotides used for DNA polymerization assays were purchased from Sigma and purified by 8M urea-20% polyacrylamide gel electrophoresis.…”

Can Designer Indels Be Tailored by Gene Editing?

“…The protein complex and exonuclease constituents of C‐NHEJ and A‐NHEJ differ, which may potentially affect the length of deletion indels. The length of insertion indels is dependent on the same exonucleases, but also dependent upon NHEJ pathway‐specific DNA polymerases or terminal transferases, some of which are template‐independent …”