A SNaPshot Assay for Determination of the Mannose-Binding Lectin Gene Variants and an Algorithm for Calculation of Haplogenotype Combinations

Abstract

Mannose-binding lectin (MBL) deficiency caused by the variability in the MBL2 gene is responsible for the susceptibility to and severity of various infectious and autoimmune diseases. A combination of six single nucleotide polymorphisms (SNPs) has a major impact on MBL levels in circulation. The aim of this study is to design and validate a sensitive and economical method for determining MBL2 haplogenotypes. The SNaPshot assay is designed and optimized to genotype six SNPs (rs1800451, rs1800450, rs5030737, rs7095891, rs7096206, rs11003125) and is validated by comparing results with Sanger sequencing. Additionally, an algorithm for online calculation of haplogenotype combinations from the determined genotypes is developed. Three hundred and twenty-eight DNA samples from healthy individuals from the Czech population are genotyped. Minor allele frequencies (MAFs) in the Czech population are in accordance with those present in the European population. The SNaPshot assay for MBL2 genotyping is a high-throughput, cost-effective technique that can be used in further genetic-association studies or in clinical practice. Moreover, a freely available online application for the calculation of haplogenotypes from SNPs is developed within the scope of this project.

Gene polymorphisms and serum levels of mannose‐binding lectin in Czech patients with recurrent aphthous stomatitis: A case–control study

“…Six MBL2 polymorphisms (rs11003125, rs7096206, rs7095891, rs5030737, rs1800450, rs1800451) were analysed by the SNaPshot assay as described previously 17 . Briefly, PCR amplification was performed in 10 μl mixture containing 1× Taq buffer without MgCl 2 , 0.3 mM of each dNTP, 0.25 μM of each primer (forward 5′‐CTGTAAACAGATTCCCCCAGTA‐3′ and reverse 5′‐GGAGGATTCAAGGCAAGTTTTC‐3′), 3 mM MgCl 2 , 0.06 U Taq DNA polymerase (Thermo Fisher Scientific), and 2 μl of genomic DNA (concentration 50 ng/μl).…”

“…16 Six MBL2 polymorphisms (rs11003125, rs7096206, rs7095891, rs5030737, rs1800450, rs1800451) were analysed by the SNaPshot assay as described previously. 17 USA) were coated overnight with 100 μl of capture antibody at a concentration of 800 ng/ml. Plates were washed thoroughly three times with wash buffer (1 Â PBS with 0.05% Tween 20) after each incubation step.…”

“…5 The human MBL2 gene is mapped on the chromosome 10 (10q11. [2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20][21] and contains a number of polymorphic loci (Figure 1) with possible functional implications. 6 Three polymorphisms in the promoter region of the MBL2 gene are: H/L (nucleotide À550), X/Y (nucleotide À221) and P/Q (at the +4 in the 5 0 UTR).…”