A single FTO gene variant rs9939609 is associated with body weight evolution in a multiethnic extremely obese population that underwent bariatric surgery

Rodrigues, Gisele Kuhlmann Duarte; Resende, Cristina Maria Mendes; Durso, Danielle Fernandes; Rodrigues, Lorena A.A.; Silva, José Luiz P.; Reis, Rodrigo Citton Padilha dos; Pereira, Sandra de Oliveira; Ferreira, Daniela Corrêa; Franco, Glória Regina; Alvarez-Leite, Jacqueline I

doi:10.1016/j.nut.2015.05.020

Cited by 38 publications

(21 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…These findings may explain our borderline association of the rs9939609 with the BMI; however, this needs to be replicated further in other cohorts in the population. The FTO variant has been reported to be involved in weight regain after bariatric surgery [23] which is considered a common obesity intervention in the Kuwaiti population [24], and therefore identifying patients at high risk of weight regain prior to intervention may help in planning the course of treatment.…”

Section: Discussionmentioning

confidence: 99%

Association of FTO rs9939609 with Obesity in the Kuwaiti Population: A Public Health Concern?

et al. 2018

View full text Add to dashboard Cite

Objective: To investigate the effect of the common fat mass and obesity-associated (FTO) gene polymorphism rs9939609 on body mass index (BMI) in one of the most obese populations worldwide. Subjects and Methods: Genotypic data for FTO rs9939609 were available for 1,034 unrelated Kuwaiti adults obtained from Kuwait’s Dasman Diabetes Institute and Kuwait University. The association between the FTO polymorphism with BMI as continuous and categorical (normal BMI [< 25] vs. overweight/obese [> 25]) variables was analyzed using both linear and logistic regression models, respectively, with the assumption of both dominant and additive genetic models performed using the SNPassoc package from R statistics. Results: The A allele was associated with increased BMI (β = 1.21; 95% CI = 0.16–2.26; p = 0.023). In concordance, the categorical BMI (normal vs. overweight/obese) also showed a significant association between the A allele and overweight/obesity (OR = 1.47; 95% CI = 1.01–2.12; p = 0.041). However, no association between the FTO variant was observed with cardiometabolic traits. Conclusion: We observed an association between the common FTO rs9939609 polymorphism and increased BMI (overweight/obesity) in Kuwaiti adults, which is consistent with previous research in other populations. Our findings encourage further investigation of genetic variants to elucidate the mechanisms involved in the development of obesity in such an obesogenic population.

show abstract

Section: Discussionmentioning

confidence: 99%

Association of FTO rs9939609 with Obesity in the Kuwaiti Population: A Public Health Concern?

et al. 2018

View full text Add to dashboard Cite

show abstract

“…In consideration of the important function of LHX3 on animal growth and reproduction, the associations between the 29 bp indel and the sheep growth traits were also analyzed. An interesting phenomenon was found in Tong sheep body length and chest width growth traits: the individuals with the II genotype showed superior traits, and the individuals with the homozygote II genotype were significantly better than those with the ID genotype; that is, the II genotype was the most conducive to growth in Tong sheep, which was a potential genetic marker used to improve Tong sheep breeding (Tepaamorndech et al, 2014;Rodrigues et al, 2015). In fact, many studies have also reported that the indel within critical genes was associated with growth traits in livestock.…”

Section: Discussionmentioning

confidence: 99%

A novel 29 bp insertion/deletion (indel) variant of the LHX3 gene and its influence on growth traits in four sheep breeds of various fecundity

Zhao

Zhu

et al. 2017

Arch. Anim. Breed.

View full text Add to dashboard Cite

Abstract. Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ 2 test (P < 0.05). Association analyses showed that body length was significantly different in female TS and STHS and that chest width was significantly different for the female TS and male STHS (P < 0.05). These findings suggested that the 29 bp indel could extend the spectrum of genetic variations of the LHX3 gene in sheep and provide a valuable theoretical basis for the marker-assisted selection (MAS) in sheep breeding and genetics.

show abstract

“…The SNP of the FTO gene that was commonly investigated regarding weight regain was rs9939609, but the results were inconsistent. Specifically, three previous studies, which include a study in children, showed that the A allele of that SNP was positively associated with weight regain (51)(52)(53) . On the other hand, a study in postmenopausal females and another two studies in subjects with impaired glucose tolerance and type 2 diabetes found there was no relationship of that SNP with weight regain (23,24,54) .…”

Section: Nutrient Metabolism-related Genes and Their Association Withmentioning

confidence: 99%

The impact of genetic polymorphisms on weight regain after successful weight loss

2020

View full text Add to dashboard Cite

Abstract Obesity is associated with an increased risk of various diseases and mortality. Although nearly 50 % of adults have been reported trying to lose weight, the prevalence of obesity has increased. One factor that hinders weight loss-induced decrease in obesity prevalence is weight regain. Although behavioural, psychological and physiological factors associated with weight regain have been reviewed, the information regarding the relationship between weight regain and genetics has not been previously summarised. In this paper, we comprehensively review the association between genetic polymorphisms and weight regain in adults and children with obesity after weight loss. Based on this information, identification of genetic polymorphism in patients who undergo weight loss intervention might be used to estimate their risks of weight regain. Additionally, the genetic-based risk estimation may be used as a guide for physicians and dietitians to provide each of their patients with the most appropriate strategies for weight loss and weight maintenance.

show abstract

A single FTO gene variant rs9939609 is associated with body weight evolution in a multiethnic extremely obese population that underwent bariatric surgery

Abstract: There is a different evolution of weight loss in obese carriers of the FTO gene variant rs9939609 after bariatric surgery. However, this pattern was evident at only 2 y postbariatric surgery, inducing a lower proportion of surgery success and a greater and earlier weight regain.

Cited by 38 publications

References 41 publications

Association of <b><i>FTO</i></b> rs9939609 with Obesity in the Kuwaiti Population: A Public Health Concern?

Association of <b><i>FTO</i></b> rs9939609 with Obesity in the Kuwaiti Population: A Public Health Concern?

A novel 29 bp insertion/deletion (indel) variant of the <i>LHX3</i> gene and its influence on growth traits in four sheep breeds of various fecundity

The impact of genetic polymorphisms on weight regain after successful weight loss

Contact Info

Product

Resources

About

A single FTO gene variant rs9939609 is associated with body weight evolution in a multiethnic extremely obese population that underwent bariatric surgery

Abstract: There is a different evolution of weight loss in obese carriers of the FTO gene variant rs9939609 after bariatric surgery. However, this pattern was evident at only 2 y postbariatric surgery, inducing a lower proportion of surgery success and a greater and earlier weight regain.

Cited by 38 publications

References 41 publications

Association of <b><i>FTO</i></b> rs9939609 with Obesity in the Kuwaiti Population: A Public Health Concern?

Association of <b><i>FTO</i></b> rs9939609 with Obesity in the Kuwaiti Population: A Public Health Concern?

A novel 29 bp insertion/deletion (indel) variant of the &lt;i&gt;LHX3&lt;/i&gt; gene and its influence on growth traits in four sheep breeds of various fecundity

The impact of genetic polymorphisms on weight regain after successful weight loss

Contact Info

Product

Resources

About

A novel 29 bp insertion/deletion (indel) variant of the <i>LHX3</i> gene and its influence on growth traits in four sheep breeds of various fecundity