A Simple Topological Filter in a Eukaryotic Transposon as a Mechanism To Suppress Genome Instability

Bouuaert, Corentin Claeys; Liu, Danxu; Chalmers, Ronald

doi:10.1128/mcb.01066-10

Cited by 29 publications

(71 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A double strand break at one transposon end generates the linear plasmid, and a double strand break at both ends excises the transposon and liberates the plasmid backbone. Integration of the excised transposon yields a mixture of inter- and intra-molecular products (29,35). …”

Section: Resultsmentioning

confidence: 99%

“…Plots display the experimental results (dots) and the predicted outcome of the two active sites models m/m[1+3/2+4] or m/m[1+4/2+3] (lines), which best fits the data. Note that the contaminating nicked substrate does not contribute significantly to the reaction because it reacts much more slowly than the supercoiled substrate (29). Numbers given above the gel lanes are transposase ratios.…”

Section: Resultsmentioning

confidence: 99%

“…Transposition reactions contained the inverted-repeat substrate pRC650 that provides a 1.7 kb transposon and a 3 kb plasmid backbone (35). Gel shift analyses used a linear fragment that carried an Hsmar1 transposon end generated from plasmid pRC919 (29). The sequences of the fragments are as follows (with transposon end sequence underlined and the flanking TA dinucleotide italicized): short (96 bp): CCGGGCTGCAGGAATTC TA TTAGGTTGGTGCAAAAGTAATTGCGGTTTT GGATCCCAAGCTTCTTCTAGAGGTACCGCATGCGATATCGAGCTCTC; long (162 bp): GCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTC TA TTAGGTTGGTGCAAAAGTAATTGCGGTTTT GGATCCCAAGCTTCTTCTAGAGGTACCGCATGCGATATCGAGCTCTCCCGGGAATTCGATATCAAGCTTATCGATACCGT.…”

Section: Methodsmentioning

confidence: 99%

“…It is clear, though, that this complex must exist because mariner cleaves single-end substrates inefficiently compared to double-ended substrates. This indicates that the PEC is a prerequisite for cleavage (29). In addition, transposon integration is concerted and intramolecular integration products retain topological information from the substrate.…”

Section: Introductionmentioning

confidence: 98%

“…In addition, transposon integration is concerted and intramolecular integration products retain topological information from the substrate. This shows that the synaptic complex must be maintained throughout catalysis (29). Nevertheless, the absence of the PEC in EMSAs has hindered the characterization of transpososome dynamics throughout the reaction.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

A single active site in the mariner transposase cleaves DNA strands of opposite polarity

Bouuaert

Chalmers

2017

Nucleic Acids Research

Self Cite

View full text Add to dashboard Cite

The RNase H structural fold defines a large family of nucleic acid metabolizing enzymes that catalyze phosphoryl transfer reactions using two divalent metal ions in the active site. Almost all of these reactions involve only one strand of the nucleic acid substrates. In contrast, cut-and-paste transposases cleave two DNA strands of opposite polarity, which is usually achieved via an elegant hairpin mechanism. In the mariner transposons, the hairpin intermediate is absent and key aspects of the mechanism by which the transposon ends are cleaved remained unknown. Here, we characterize complexes involved prior to catalysis, which define an asymmetric pathway for transpososome assembly. Using mixtures of wild-type and catalytically inactive transposases, we show that all the catalytic steps of transposition occur within the context of a dimeric transpososome. Crucially, we find that each active site of a transposase dimer is responsible for two hydrolysis and one transesterification reaction at the same transposon end. These results provide the first strong evidence that a DDE/D active site can hydrolyze DNA strands of opposite polarity, a mechanism that has rarely been observed with any type of nuclease.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 98%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

A single active site in the mariner transposase cleaves DNA strands of opposite polarity

Bouuaert

Chalmers

2017

Nucleic Acids Research

Self Cite

View full text Add to dashboard Cite

show abstract

Kinetic Analysis of the Interaction of Mos1 Transposase with its Inverted Terminal Repeats Reveals New Insight into the Protein–DNA Complex Assembly

et al. 2014

View full text Add to dashboard Cite

Transposases are specific DNA-binding proteins that promote the mobility of discrete DNA segments. We used a combination of physicochemical approaches to describe the association of MOS1 (an eukaryotic transposase) with its specific target DNA, an event corresponding to the first steps of the transposition cycle. Because the kinetic constants of the reaction are still unknown, we aimed to determine them by using quartz crystal microbalance on two sources of recombinant MOS1: one produced in insect cells and the other produced in bacteria. The prokaryotic-expressed MOS1 showed no cooperativity and displayed a Kd of about 300 nM. In contrast, the eukaryotic-expressed MOS1 generated a cooperative system, with a lower Kd (∼ 2 nm). The origins of these differences were investigated by IR spectroscopy and AFM imaging. Both support the conclusion that prokaryotic- and eukaryotic-expressed MOS1 are not similarly folded, thereby resulting in differences in the early steps of transposition.

show abstract

The emerging diversity of transpososome architectures

Dyda

Chandler

Hickman

2012

Quart. Rev. Biophys.

View full text Add to dashboard Cite

DNA transposases are enzymes that catalyze the movement of discrete pieces of DNA from one location in the genome to another. Transposition occurs through a series of controlled DNA strand cleavage and subsequent integration reactions that are carried out by nucleoprotein complexes known as transpososomes. Transpososomes are dynamic assemblies which must undergo conformational changes that control DNA breaks and ensure that, once started, the transposition reaction goes to completion. They provide a precise architecture within which the chemical reactions involved in transposon movement occur, but adopt different conformational states as transposition progresses. Their components also vary as they must, at some stage, include target DNA and sometimes even host-encoded proteins. A very limited number of transpososome states have been crystallographically captured, and here we provide an overview of the various structures determined to date. These structures include examples of DNA transposases that catalyze transposition by a cut-and-paste mechanism using an RNaseH-like nuclease catalytic domain, those that transpose using only single-stranded DNA substrates and targets, and the retroviral integrases that carry out an integration reaction very similar to DNA transposition. Given that there are a number of common functional requirements for transposition, it is remarkable how these are satisfied by complex assemblies that are so architecturally different.

show abstract

A Simple Topological Filter in a Eukaryotic Transposon as a Mechanism To Suppress Genome Instability

Cited by 29 publications

References 32 publications

A single active site in the mariner transposase cleaves DNA strands of opposite polarity

A single active site in the mariner transposase cleaves DNA strands of opposite polarity

Kinetic Analysis of the Interaction of Mos1 Transposase with its Inverted Terminal Repeats Reveals New Insight into the Protein–DNA Complex Assembly

The emerging diversity of transpososome architectures

Contact Info

Product

Resources

About