A simple colorimetric analytical assay using gold nanoparticles for specific detection of tetracycline in environmental water samples

Qi, Mengyu; Tu, Chunyan; Dai, Yuanyuan; Wang, Weiping; Wang, Ai‐Jun; Chen, Jianrong

doi:10.1039/c8ay00713f

Cited by 38 publications

(14 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As a result, the degree of AuNP aggregation is a direct reflection of the target concentration and can be observed by the red to purple-blue color change in the AuNP solution. Based on the similar strategies, the label-free colorimetric detection of various targets, including proteins [77,78,79,80], small organic molecules [81,82,83], and ions, such as silver (I) [84], cadmium (II) [85] and potassium (I) [86], has been explored extensively.…”

Section: Aggregation-based Colorimetric Assaysmentioning

confidence: 99%

Gold Nanoparticle-Based Colorimetric Strategies for Chemical and Biological Sensing Applications

et al. 2019

View full text Add to dashboard Cite

Gold nanoparticles are popularly used in biological and chemical sensors and their applications owing to their fascinating chemical, optical, and catalytic properties. Particularly, the use of gold nanoparticles is widespread in colorimetric assays because of their simple, cost-effective fabrication, and ease of use. More importantly, the gold nanoparticle sensor response is a visual change in color, which allows easy interpretation of results. Therefore, many studies of gold nanoparticle-based colorimetric methods have been reported, and some review articles published over the past years. Most reviews focus exclusively on a single gold nanoparticle-based colorimetric technique for one analyte of interest. In this review, we focus on the current developments in different colorimetric assay designs for the sensing of various chemical and biological samples. We summarize and classify the sensing strategies and mechanism analyses of gold nanoparticle-based detection. Additionally, typical examples of recently developed gold nanoparticle-based colorimetric methods and their applications in the detection of various analytes are presented and discussed comprehensively.

show abstract

Section: Aggregation-based Colorimetric Assaysmentioning

confidence: 99%

Gold Nanoparticle-Based Colorimetric Strategies for Chemical and Biological Sensing Applications

et al. 2019

View full text Add to dashboard Cite

show abstract

“…This method was reported for the detection of Ag + , [59] kanamycin, [60,61] chloramphenicol, [62,63] 17β-estradiol, [64] melamine [65,66] and tetracycline. [67][68][69] To test this mechanism, we quantitatively measured the amount of desorbed aptamers in the presence of various target molecules using a few FAM-labeled aptamers (Figure 3). [23] If an aptamer is specifically desorbed, higher fluorescence enhancement would be observed with its target than with other molecules.…”

Section: Figure 2 (A)mentioning

confidence: 99%

“…This method was also used for detecting various antibiotics such as kanamycin, [60,61] tetracycline, [67][68][69] chloramphenicol, [62,63] sulfadimethoxine, [47,48] biological analytes like 17β-estradiol, [64] ATP, [50,57,58] environmental and food contaminants like bisphenol A, [49] and melamine (M), [65,66] and illicit drugs including cocaine (O), [54,80] and methamphetamine (P). [51] These ions and molecules have vastly different structures and properties, leading to different interactions with AuNPs.…”

Section: Examples Of Targets For Aptamer-based Detectionmentioning

confidence: 99%

“…uM [46] (1) G Kanamycin TGGGGGTTGAGGCTAAGCCGA~40 nM [60] (4) [60,61] H Tetracycline CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGG TCCCACTGCGCGTGGATCCGAGCTCCACGTG~4 0 uM [67] (4) [67][68][69] I Chloramphenicol ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAG~160 nM [62,63] (4) [b] [62,63] J Sulfadimethoxine GAGGGCAACGAGTGTTTATAGA NA (1) [47,48]…”

Section: Ggtaatacgactcactatagggagataccagcttattcaattttaca Gaacaaccaacgmentioning

confidence: 99%

See 1 more Smart Citation

Label‐Free Colorimetric Biosensors Based on Aptamers and Gold Nanoparticles: A Critical Review

Zhang

Liu

2020

Analysis & Sensing

View full text Add to dashboard Cite

Taking advantage of the adsorption of single‐stranded DNA oligonucleotides by gold nanoparticles (AuNPs) and the protection effect of the adsorbed DNA against salt‐induced aggregation of AuNPs, a label‐free colorimetric sensor for the detection of DNA was reported in 2004. Since then, the range of target molecules has extended from complementary nucleic acids to metal ions and small molecules by using aptamers. In the presence of target molecules, a blue color arising from aggregated AuNPs is expected. However, these sensors only considered aptamer binding to its target, and the adsorption of aptamers by AuNPs, while the target/AuNP interactions were ignored. We recently found that target adsorption can often dominate the system. In this Review, we list literature examples of using this label‐free strategy for sensing aptamer targets. Seven target analytes are discussed in detail. For As(III), dopamine, melamine, kanamycin, adenosine, and ATP, target adsorption dominated, and the same color change was observed even with non‐aptamer sequences. Only in the case of K+ detection, did the effect of specific aptamer binding dominate, attributable to weak K+/AuNP interactions. These examples call for a careful evaluation of target adsorption and the use of non‐aptamer control sequences in validating these sensors.

show abstract

“…In the field of food detection, they have an extremely broad usage for the detection of small molecules, and they rival antibodies to some degree. Aptamers have been used to detect small molecules including patulin [ 7 ], ochratoxin [ 8 ], ractopamine [ 9 ] chloramphenicol [ 10 ], clenbuterol [ 11 ], aflatoxin B1 [ 12 ], and tetracycline [ 13 ]. The ochratoxin aptamer [ 14 , 15 , 16 ] is the most commonly used aptamer, also known as the star aptamer.…”

Section: Introductionmentioning

confidence: 99%

Selection and Identification of Novel Aptamers Specific for Clenbuterol Based on ssDNA Library Immobilized SELEX and Gold Nanoparticles Biosensor

et al. 2018

View full text Add to dashboard Cite

We describe a multiple combined strategy to discover novel aptamers specific for clenbuterol (CBL). An immobilized ssDNA library was used for the selection of specific aptamers using the systematic evolution of ligands by exponential enrichment (SELEX). Progress was monitored using real-time quantitative PCR (Q-PCR), and the enriched library was sequenced by high-throughput sequencing. Candidate aptamers were picked and preliminarily identified using a gold nanoparticles (AuNPs) biosensor. Bioactive aptamers were characterized for affinity, circular dichroism (CD), specificity and sensitivity. The Q-PCR amplification curve increased and the retention rate was about 1% at the eighth round. Use of the AuNPs biosensor and CD analyses determined that six aptamers had binding activity. Affinity analysis showed that aptamer 47 had the highest affinity (Kd = 42.17 ± 8.98 nM) with no cross reactivity to CBL analogs. Indirect competitive enzyme linked aptamer assay (IC-ELAA) based on a 5′-biotin aptamer 47 indicated the limit of detection (LOD) was 0.18 ± 0.02 ng/L (n = 3), and it was used to detect pork samples with a mean recovery of 83.33–97.03%. This is the first report of a universal strategy including library fixation, Q-PCR monitoring, high-throughput sequencing, and AuNPs biosensor identification to select aptamers specific for small molecules.

show abstract

A simple colorimetric analytical assay using gold nanoparticles for specific detection of tetracycline in environmental water samples

Abstract: In this work, an aptamer-based colorimetric method for the detection of tetracycline (TC) was established by employing gold nanoparticles (AuNPs) as the colorimetric probe.

Cited by 38 publications

References 53 publications

Gold Nanoparticle-Based Colorimetric Strategies for Chemical and Biological Sensing Applications

Gold Nanoparticle-Based Colorimetric Strategies for Chemical and Biological Sensing Applications

Label‐Free Colorimetric Biosensors Based on Aptamers and Gold Nanoparticles: A Critical Review

Selection and Identification of Novel Aptamers Specific for Clenbuterol Based on ssDNA Library Immobilized SELEX and Gold Nanoparticles Biosensor

Contact Info

Product

Resources

About