A Short Pseudoautosomal Region in Laboratory Mice

Abstract

The pseudoautosomal region (PAR) of mammalian sex chromosomes is a small region of sequence identity that is the site of an obligatory pairing and recombination event between the X and Y chromosomes during male meiosis. During female meiosis, X chromosomes can pair and recombine along their entire length; recombination in the PAR is therefore approximately 10x greater in male meiosis compared with female meiosis. A consequence of the presence of the PAR in two copies in males and females is that genes in the region escape the process of X-inactivation. Although the structure and gene content of the human PAR at Xq/Yq is well understood, the mouse PAR, which appears to be of independent evolutionary origin, is poorly characterized. Here we describe a yeast artificial chromosome (YAC) contig covering the distal part of the mouse X chromosome, which we have used to define the pseudoautosomal boundary, that is, the point of divergence of X-specific and X-Y-identical sequences. In addition, we have investigated the size of the mouse PAR by integrating a unique restriction endonuclease recognition site just proximal to the pseudoautosomal boundary by homologous recombination. Restriction digestion of this modified DNA and pulsed field gel electrophoresis reveal that the PAR in these cells is approximately 700 kb. Thus, the mouse PAR, although small in size, has retained essential sex chromosome pairing functions despite its rapid rate of evolution.

X-linked microtubule-associated protein, Mid1, regulates axon development

“…Given that knockdown of Mid1 resulted in increased axon outgrowth both in vitro and in vivo, we next sought to determine whether a similar axonal phenotype existed in Mid1 KO mice (24). By comparing the morphology of cortical neurons cultured from WT and KO mice cortices, we found the axon length and branch number increased in KO neurons, which is consistent with the RNAi experiment (Fig.…”

“…Mid1 mutant mice, a kind gift from Timothy Cox, were genotyped as described previously (24). We also used female ICR and C57BL/6 mice in in utero electroporation experiments.…”

ATlr7translocation accelerates systemic autoimmunity in murine lupus

“…2A Upper) (www. ensembl.org͞Mus musculus) (25). The expression of these four genes was 2-fold greater in CD19 B cells from yaa strains compared with B6 ( Fig.…”

Role of RAD51C and XRCC3 in Genetic Recombination and DNA Repair

“…Two 50 -60-day-old male mice (strain 129OLA) were used for each experiment. The immunoprecipitated genomic DNA was then PCR-amplified using pairs of primers (34,35): the DXYCbl1 XY marker (282 bp) was generated with CACTATAGTTTTGGCCATAG and GGACGT-GTATAATCTGGATG; the DXYCbl3 XY marker (194 bp) with GCCTGAGCAGCATAAAAGAC and TAGGACTAAC-AAGAGAGGTG; the DXCbl1 X marker (185 bp) with ATCT-ATCCCTTTTTCTGAGG and CAACATGTTGACAAGTT-TGG; and the Y4.2M Y marker (208 bp) with AAGAAATAA-AAGAACCATAG and GCCTTCATGGAATCAGTATT.…”