A robust system for RNA interference in the chicken using a modified microRNA operon

Abstract

RNA interference (RNAi) provides an effective method to silence gene expression and investigate gene function. However, RNAi tools for the chicken embryo have largely been adapted from vectors designed for mammalian cells. Here we present plasmid and retroviral RNAi vectors specifically designed for optimal gene silencing in chicken cells. The vectors use a chicken U6 promoter to express RNAs modelled on microRNA30, which are embedded within chicken microRNA operon sequences to ensure optimal Drosha and Dicer processing of transcripts. The chicken U6 promoter works significantly better than promoters of mammalian origin and in combination with a microRNA operon expression cassette (MOEC), achieves up to 90% silencing of target genes. By using a MOEC, we show that it is also possible to simultaneously silence two genes with a single vector. The vectors express either RFP or GFP markers, allowing simple in vivo tracking of vector delivery. Using these plasmids, we demonstrate effective silencing of Pax3, Pax6, Nkx2.1, Nkx2.2, Notch1 and Shh in discrete regions of the chicken embryonic nervous system. The efficiency and ease of use of this RNAi system paves the way for large-scale genetic screens in the chicken embryo.

FatJ acts via the Hippo mediator Yap1 to restrict the size of neural progenitor cell pools

“…RNAi targeting vectors were designed as previously described (Das et al, 2006). However, the RNAi vectors used in this study were created using an updated RNAi vector (pRFPRNAiC) containing a MluI site instead of the AflII site in the microRNA expression cassette.…”

“…We have previously developed a system for robust knockdown of chicken genes (Das et al, 2006). In the present study, we employ this system to knockdown the expression of all cadherin domaincontaining genes expressed within the chicken neural tube and thereby analyse cadherin gene function during neural development.…”

p27Kip1participates in the regulation of endoreplication in differentiating chick retinal ganglion cells

“…51 . Two independent vectors were designed, one targeting the 5 0 region (1p27i) and another one targeting the 3 0 region (2p27i) of the Cdkn1b mRNA.…”

“…51 . The 1p27i construct (1p27i) was generated by targeting the sequence found between 93 and 112 base pairs (bp) (GCCATGGAGGATTACACGAA).…”

“…Once generated, these constructs were cloned into the pRFPRNAiC vector. 51 pRFPRNAi luciferase (Luc-i) 51 was used as negative control. All these plasmids co-express red fluorescent protein (RFP).…”