A revision of the nucleotide sequence and functional map of pUB110

McKenzie, Timothy; Hoshino, Takayuki; Takano, Teruo; Sueoka, Noboru

doi:10.1016/0147-619x(87)90015-1

Cited by 57 publications

(21 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The predicted anticodon for the tryptophan codon UGG is 3'ACC, and the anticodon for (10). Interestingly, a single strain of B. subtilis that is reportedly cured of the prophage SP,B (strain YB886) also suppressed UGA-7, suggesting that the prophage was not responsible for the observed suppression (data not shown).…”

mentioning

confidence: 84%

UGA can be decoded as tryptophan at low efficiency in Bacillus subtilis

et al. 1991

View full text Add to dashboard Cite

Replacement of cat-86 codon 7 or 144 with the UGA codon permitted the gene to confer chloramphenicol resistance in wild-type Bacillus subtilis. UAA replacements of the same codons resulted in a chloramphenicol-sensitive phenotype in wild-type B. subtilis and a chloramphenicol-resistant phenotype in suppressor-positive strains. N-terminal sequencing showed that UGA at codon 7 was decoded as tryptophan in wild-type cells, at an efficiency of about 6%.

show abstract

mentioning

confidence: 84%

UGA can be decoded as tryptophan at low efficiency in Bacillus subtilis

et al. 1991

View full text Add to dashboard Cite

show abstract

“…**** 5*** *************** ********* . ** * ** *** TTrTG---CITITCCTCGT AAAAAAAGAAAGGTCTTAAAGGTITTATGGITTGGTCGGCACTGCCGACAGCCTCGCAGAGCACACACTTrA 3571 ****** ----TTTIT C********'** * T AC*************************************************************** ITITEG----TTrUrrTrrCrCGTAAAAAAGAAAGGTCrrAAAGG1"TITATGGnlTlGGTCGGCACTGCCGACAGCCrrGCAGAGCACACACIT1TA 1175 (14), and pUB110 (23,24). Dots over the pMV158 sequence indicate 10-bp intervals in this plasmid.…”

mentioning

confidence: 99%

Region of the streptococcal plasmid pMV158 required for conjugative mobilization

Priebe

Lacks

1989

J Bacteriol

View full text Add to dashboard Cite

The nonconjugative streptococcal plasmid pMV158 can be mobilized by the conjugative streptococcal plasmid pIP501. We determined the sequence of the 1.1-kilobase EcoRI fragment of pMV158 to complete the DNA sequence of the plasmid. We showed that an open reading frame, mob (able to encode a polypeptide of 58,020 daltons), is required for mobilization of pMV158. An intergenic region present in the EcoRI fragment contains four lengthy palindromes that are found also in one or more of the staphylococcal plasmids pT181, pE194, and pUBIIO. One palindromic sequence, palD, which is common to all four plasmids, also appeared to be necessary for mobilization. Circumstantial evidence indicates that this sequence contains both an oriT site and the mob promoter. The Mob protein is homologous in its amino-terminal half to Pre proteins encoded by pT181 and pE194 that were shown by others to be essential for site-specific cointegrative plasmid recombination; their main biological function may be plasmid mobilization.A variety of conjugative and nonconjugative plasmids are found in streptococcal species (for a review, see reference 6). The conjugative plasmid pIP501 confers erythromycin resistance (Emr) and chloramphenicol resistance (Cm'-). This 30-kilobase (kb) plasmid was found by Horodniceanu and co-workers in a strain of Streptococcus ag(llactiae (15) and shown to pass conjugatively into various streptococcal species (13). The 5.5-kb nonconjugative plasmid pMV158 confers tetracycline resistance (Tcr); it was found by Burdett in another strain of S. agalactiae (5). Guild and co-workers transferred the two plasmids into Str eptococcils pneitnoniae by transformation (32). They showed that when both plasmids were present in the same cell, pIP501 was able to mobilize pMV158 for conjugative transfer. In this work, we inquired into the molecular basis of such mobilization.A derivative of pMV158 called pLS1, which was constructed by removal of a 1.1-kb EcoRI fragment, replicates normally in S. pneirmoniae (33). Both pMV158 and pLS1 also replicate in other gram-positive bacteria, such as Bacillus sibtilis (11), and in gram-negative bacteria, such as Escherichia coli (20 Novick and co-workers found that recombination between two staphylococcal plasmids, pT181 and pE194, to give a cointegrate product occurred within closely related 70-basepair (bp) sequences (called RSA) in these plasmids (12,25). This site-specific recombination was independent of a )ecA mutation, but it required a protein called Pre (for plasmid recombination), encoded by a plasmid gene, pi-e (12). The * Corresponding author. pre gene product of either pT181 or pE194 could promote recombination, and the pT181 protein was shown to act in tr'atis, that is, when the active pre gene was present on a plasmid not participating in the cointegrate formation (12). The Pre proteins predicted from the DNA sequence of pT181 and pE194 appeared to be homologous, and it was pointed out that another staphylococcal plasmid, pUB110, contains a sequence identifical to part of RSA and ...

show abstract

“…During the course of this work, it became apparent that a region common to both pUB110 and pBC16 (29) was necessary for mobilization of these plasmids by helper plasmids such as pLS20. This region corresponds to that containing ORF-P described by 26). ORF-P has been shown to have a high homology to the pre (plasmid recombination enzyme) locus of pT181 and pE194 (12), which is believed to mediate recA-independent recombination at RSA, a site located 5' to pre and ORF-p.…”

mentioning

confidence: 99%

“…The sequence of pUJ3110 has revealed four ORFs: neo, ORF-a, ORF-p, and ORF--y, of which only ORF-3 is uncharacterized (25,26). Open reading frames neo and ORF--y encode resistance genes for the antibiotics neomycin-kanamycin and phleomycin-bleomycin, respectively (24,33).…”

mentioning

confidence: 99%

Mobilization of closely related plasmids pUB110 and pBC16 by Bacillus plasmid pXO503 requires trans-acting open reading frame beta

Selinger¹,

McGregor²,

Khachatourians³

et al. 1990

J Bacteriol

View full text Add to dashboard Cite

Genetic analysis of the closely related nonconjugative plasmids pUB110 and pBC16 has demonstrated that the open reading frame (ORF-P) region in pUB110 and the corresponding homologous region in pBC16 are essential for mobilization of these plasmids by pLS20 or its derivatives. Deletions in this region or insertions that interrupted ORF-,B severely impaired or eliminated the mobilization of pUB110:: pUC18 and pBC16::pUC18 hybrids. In contrast, a hybrid in which pUC18 was inserted into pBC16 at a point outside ORF-j transferred at a frequency comparable to that of intact pUB110 or pBC16 (10-4 transcipients per donor cell). The defect of most transfer-deficient (Mob-) hybrid plasmids could be complemented by an intact sister plasmid (i.e., pBC16 for pUB110::pUC18 Mob-hybrids In gram-negative bacteria such as Escherichia coli, many small nonconjugative plasmids, including ColEl, RSF1010, and Clo DF13, can be transferred by conjugation to other strains if a conjugative helper plasmid is present (8,9,11,20,34,36,37). Sequences borne by nonconjugative plasmids, including a cis-acting origin of transfer (oriT; 9, 11, 34, 36, 38) and a region(s) encoding trans-acting mob gene products (8,20,34,36,37), are also necessary for mobilization.Examination of Staphylococcus aureus plasmid pC221 (31) has revealed comparable regions necessary for mobilization. Three loci, including two open reading frames (ORFs), orfA and orfB, encoding trans-acting products, and a cis-acting region are necessary for mobilization of pC221 by pGO1. The cis-acting region (oriT) and orfA (mobA) function in the relaxation of the covalently closed circular form of pC221 to open circular DNA molecules. The function of orfB remains to be determined. These results indicate that mobilization of nonconjugative plasmids in gram-positive bacteria takes place by mechanisms similar to those observed in gram-negative bacteria.It has also been reported that pUB110 and pBC16, two closely related single-stranded DNA plasmids (5, 15, 28) isolated from S. aureus (7, 16) and Bacillus cereus (3), respectively, can be mobilized by pLS20 (21) and pXOll and pXO12 (1). It has not yet been shown which sequences, if any, on pUB110 and pBC16 are necessary for mobilization.The sequence of pUJ3110 has revealed four ORFs: neo, ORF-a, ORF-p, and ORF--y, of which only ORF-3 is uncharacterized (25, 26). Open reading frames neo and ORF--y encode resistance genes for the antibiotics neomycin-kanamycin and phleomycin-bleomycin, respectively (24,33 ORF-a is involved in plasmid replication because of its close proximity to the ori region and the inability of plasmids lacking this region to replicate (32). This has been confirmed by Gros and co-workers (13), who have shown that the ORF-a gene product is a replication protein. In comparison, the region necessary for replication of pBC16 is located adjacent to the tetracycline resistance determinant (22).We are interested in the genetics of plant growth-promoting Bacillus spp. For this reason, we have been investigating means of introduci...

show abstract

A revision of the nucleotide sequence and functional map of pUB110

Cited by 57 publications

References 3 publications

UGA can be decoded as tryptophan at low efficiency in Bacillus subtilis

UGA can be decoded as tryptophan at low efficiency in Bacillus subtilis

Region of the streptococcal plasmid pMV158 required for conjugative mobilization

Mobilization of closely related plasmids pUB110 and pBC16 by Bacillus plasmid pXO503 requires trans-acting open reading frame beta

Contact Info

Product

Resources

About