A recurrent deletion in the SLC5A2 gene including the intron 7 branch site responsible for familial renal glucosuria

Zhao, Xiangzhong; Cui, Li; Lang, Yanhua; Liu, Ting; Lu, Jingru; Wang, Cui; Tuffery‐Giraud, Sylvie; Bottillo, Irene; Wang, Xinsheng; Shao, Leping

doi:10.1038/srep33920

Cited by 18 publications

(17 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the current study, we found two splice site variants: IVS1-16C > A and c.1152-63del. However, the effect of these two splicesite variants has been verified in previous studies [13,22]. Therefore, we did not retest the effect of splice-site variants in cDNA in the current study.…”

Section: Discussionmentioning

confidence: 77%

“…Renal biopsy is not obligatory for FRG patients; therefore, SLC5A2 cDNA from the kidney is almost impossible to obtain. Although there are a few reports about splice-site variants [4,5,22,23], the effect of splice-site variants is very difficult to verify in cDNA. We searched through NCBI GEO profiles and found that the SGLT2 protein can be expressed in peripheral white blood cells and lymphocytes.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

Liu

Hou

et al. 2020

BMC Nephrol

View full text Add to dashboard Cite

Background: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. Methods: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. Results: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(−10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_ Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. Conclusion: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(−10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

show abstract

Section: Discussionmentioning

confidence: 77%

Section: Discussionmentioning

confidence: 99%

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

Liu

Hou

et al. 2020

BMC Nephrol

View full text Add to dashboard Cite

show abstract

“…No further variant explaining the patient phenotype could be found in the whole-exome sequencing data. In order to test the functional significance of c.706-2A>C, we performed a minigene splicing assay with the pSPL3 vector [14] ( Fig. 3a).…”

Section: Resultsmentioning

confidence: 99%

“…The minigene splicing assay was performed as previously described [14]. PCR fragments of CYP26C1 intron3-exon4-intron4 genomic region were cloned into the splicing vector pSPL3 using specific primers linking the EcoRI and BamHI restriction enzyme sites (forward primer 5′-GTA-CAGGGAAAGGGCAATGG-3′; reverse primer 5′-GAGTTTGATCCTGAGCCCCT-3′).…”

Section: Minigene Splicing Assaymentioning

confidence: 99%

Functional missense and splicing variants in the retinoic acid catabolizing enzyme CYP26C1 in idiopathic short stature

et al. 2018

View full text Add to dashboard Cite

Height is a complex quantitative trait with a high heritability. Short stature is diagnosed when height is significantly below the average of the general population for that person's age and sex. We have recently found that the retinoic acid degrading enzyme CYP26C1 modifies SHOX deficiency phenotypes toward more severe clinical manifestations. Here, we asked whether damaging variants in CYP26C1 alone could lead to short stature. We performed exome and Sanger sequencing to analyze 856 individuals with short stature where SHOX deficiency was previously excluded. Three different damaging missense variants and one splicing variant were identified in six independent individuals; the functional significance of the identified variants was tested in vitro or in vivo using zebrafish as a model. The genetic and functional data reported here indicate that CYP26C1 represents a novel gene underlying growth disorders and that damaging variants in the absence of SHOX variants can lead to short stature.

show abstract

“…To investigate the effect of the splice site mutation located in intron 3 (c.526 + 1G>A), we designed a minigene including exon 3 and part of introns 2 and 3 of the EDA gene using the exon trapping pSPL3 plasmids (Invitrogen Corporation, Carlsbad, CA, USA; Zhao et al., ; Kimani et al., ). Fragments encoding the wild‐type or mutant alleles involving exon 3 (24 bp) and flanked by the upstream (144 bp) and downstream (141 bp) intronic sequences were cloned into the pSPL3 splicing vector using specific primers incorporating the 5′ Eco R I and 3′ Sac I restriction enzyme sites.…”

Section: Methodsmentioning

confidence: 99%

A novel splicing mutation of ectodysplasin A gene responsible for hypohidrotic ectodermal dysplasia

et al. 2018

View full text Add to dashboard Cite

Hypohidrotic ectodermal dysplasia (HED) is characterized by hypohidrosis, hypodontia, sparse hair, and characteristic facial features. This condition is caused by an ectodysplasin A (EDA) gene mutation. In this study, we examined two HED pedigrees and investigated the molecular genetics of the defect. Direct sequencing analysis revealed a previously unidentified mutation in the EDA splice donor site (c.526 + 1G>A). The function of the mutant EDA gene was predicted through online investigations and subsequently confirmed by splicing analysis in vitro. The mutation resulted in the production of a truncated EDA-A1 protein caused by complete omission of exon 3. This novel functional skipping-splicing EDA mutation was considered to be the cause of HED in the two pedigrees reported here. Our findings, combined with those reported elsewhere, provide an improved understanding of the pathogenic mechanism of HED as well as important information for a genetic diagnosis.

show abstract

A recurrent deletion in the SLC5A2 gene including the intron 7 branch site responsible for familial renal glucosuria

Cited by 18 publications

References 22 publications

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

Functional missense and splicing variants in the retinoic acid catabolizing enzyme CYP26C1 in idiopathic short stature

A novel splicing mutation of ectodysplasin A gene responsible for hypohidrotic ectodermal dysplasia

Contact Info

Product

Resources

About