A recombinant measles virus expressing biologically active human interleukin-12.

Singh, Mahender; Billeter, Martin

doi:10.1099/0022-1317-80-1-101

Cited by 59 publications

(49 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It would be interesting to see if that position reverts to Lys on continued passage and what effect the mutation has on the relative fitness of rescued virus. Now that MUV can be rescued from cDNA, it may be possible to engineer the virus genome of express foreign genes, as described for a number of other negative-sense RNA viruses (13,14,16,21,34,36). The ability to do this may provide an ideal means to deliver prophylactic and therapeutic agents for the prevention and treatment of diseases other than mumps.…”

Section: Discussionmentioning

confidence: 99%

Rescue of Mumps Virus from cDNA

Clarke

Sidhu

Johnson

et al. 2000

J Virol

View full text Add to dashboard Cite

A complete DNA copy of the genome of a Jeryl Lynn strain of mumps virus (15,384 nucleotides) was assembled from cDNA fragments such that an exact antigenome RNA could be generated following transcription by T7 RNA polymerase and cleavage by hepatitis delta virus ribozyme. The plasmid containing the genome sequence, together with support plasmids which express mumps virus NP, P, and L proteins under control of the T7 RNA polymerase promoter, were transfected into A549 cells previously infected with recombinant vaccinia virus (MVA-T7) that expressed T7 RNA polymerase. Rescue of infectious virus from the genome cDNA was demonstrated by amplification of mumps virus from transfected-cell cultures and by subsequent consensus sequencing of reverse transcription-PCR products generated from infected-cell RNA to verify the presence of specific nucleotide tags introduced into the genome cDNA clone. The only coding change (position 8502, A to G) in the cDNA clone relative to the consensus sequence of the Jeryl Lynn plaque isolate from which it was derived, resulting in a lysine-to-arginine substitution at amino acid 22 of the L protein, did not prevent rescue of mumps virus, even though an amino acid alignment for the L proteins of paramyxoviruses indicates that lysine is highly conserved at that position. This system may provide the basis of a safe and effective virus vector for the in vivo expression of immunologically and biologically active proteins, peptides, and RNAs.

show abstract

Section: Discussionmentioning

confidence: 99%

Rescue of Mumps Virus from cDNA

Clarke

Sidhu

Johnson

et al. 2000

J Virol

View full text Add to dashboard Cite

show abstract

“…Expression of foreign proteins by several members of the Paramyxoviridae has been reported (Bukreyev et al, 1996;Mebatsion et al, 1996;He et al, 1997;Johnson et al, 1997;Roberts et al, 1998;Baron et al, 1999;Singh & Billeter, 1999;Bailly et al, 2000;Buchholz et al, 2000;Durbin et al, 2000;Krishnamurthy et al, 2000;Huang et al, 2001;Nakaya et al, 2001). In most of these cases, the foreign gene was inserted at a specific position in the viral genome and no systematic attempts were made to examine the effects of the position of the foreign gene on expression levels and virus replication.…”

Section: Discussionmentioning

confidence: 99%

Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication

Zhao¹,

Peeters²

2003

Journal of General Virology

View full text Add to dashboard Cite

Newcastle disease virus (NDV) was examined for its suitability as a vector for the expression and delivery of foreign genes for vaccination and gene therapy. A reporter gene encoding human secreted alkaline phosphatase (SEAP) was inserted as an additional transcription unit at four different positions in the NDV genome, between the NP and P, M and F, and HN and L genes and behind the L gene. Eight infectious recombinant NDV (rNDV) viruses, four in the non-virulent strain NDFL and four in the virulent derivative NDFLtag, were generated by reverse genetics. SEAP expression levels, replication kinetics and virus yield were examined. Replication kinetics of the rNDV viruses in primary chicken embryo fibroblasts showed that the insertion of an additional gene resulted in a delay in the onset of replication. This effect was most prominent when the gene was inserted between the NP and P genes. With the exception of the strain that carried the SEAP gene behind the L gene, all recombinant strains expressed high levels of SEAP, both in cell culture and in embryonated chicken eggs. In embryonated eggs, the rNDV viruses showed a 2?6-to 5?6-fold (NDFL) or 2?1-to 8?1-fold (NDFLtag) reduction in yield compared with the parent strains. These results show that foreign genes can be inserted at different positions in the NDV genome without severely affecting replication efficiency or virus yield.

show abstract

“…To obtain p(ϩ)MV-N/GFP, a BsiWI restriction site was introduced downstream of the N gene stop codon in pCG-N-P [intermediate plasmid containing the N ORF and part of the P ORF, fragment ScaI-StuI from p(ϩ)MV-NSe (58)]. The same restriction site (underlined) was introduced downstream of the GFP stop codon in pCG-N/GFP, using primers 5Ј-GTGTA CAATGACAGAAATCTTCTAGACTAGCGTACGGTGCGAGAGGCCGA GGACCAG and 5Ј-GCATGGACGAGCTGTACAAGTAGCGACGTACGAT GCAAGCTGATCTTTTTCCCTCTGCC.…”

Section: Methodsmentioning

confidence: 99%

Measles Virus Phosphoprotein Gene Products: Conformational Flexibility of the P/V Protein Amino-Terminal Domain and C Protein Infectivity Factor Function

Devaux

Cattaneo

2004

J Virol

View full text Add to dashboard Cite

The measles virus (MV) P gene codes for three proteins: P, an essential polymerase cofactor, and V and C, which have multiple functions but are not strictly required for viral propagation in cultured cells. V shares the amino-terminal domain with P but has a zinc-binding carboxyl-terminal domain, whereas C is translated from an overlapping reading frame. During replication, the P protein binds incoming monomeric nucleocapsid (N) proteins with its amino-terminal domain and positions them for assembly into the nascent ribonucleocapsid. The P protein amino-terminal domain is natively unfolded; to probe its conformational flexibility, we fused it to the green fluorescent protein (GFP), thereby also silencing C protein expression. A recombinant virus (MV-GFP/P) expressing hybrid GFP/P and GFP/V proteins in place of standard P and V proteins and not expressing the C protein was rescued and produced normal ratios of mono-, bi-, and tricistronic RNAs, but its replication was slower than that of the parental virus. Thus, the P protein retained nearly intact polymerase cofactor function, even with a large domain added to its amino terminus. Having noted that titers of cellassociated and especially released MV-GFP/P were reduced and knowing that the C protein of the related Sendai virus has particle assembly and infectivity factor functions, we produced an MV-GFP/P derivative expressing C. Intracellular titers of this virus were almost completely restored, and those of released virus were partially restored. Thus, the MV C protein is an infectivity factor.Measles (MV) is an enveloped virus with a nonsegmented negative-strand RNA genome belonging to the Morbillivirus genus of the Paramyxoviridae family (37). The MV genome, as that of other Paramyxoviridae, including the model species Sendai virus (SeV), is tightly encapsidated by nucleocapsid (N) proteins, each one covering exactly 6 bp and forming a nuclease-resistant helical ribonucleocapsid (RNP) (19, 50). As initially inferred by analogy with SeV, the MV N protein is divided in a large well-conserved core domain, comprising most of the protein and supporting self-assembly and RNA binding (6), and a hypervariable small carboxyl-terminal tail that is intrinsically disordered (38). The N protein tail is also required for the RNP to act as a template for viral RNA synthesis (5,15,65).Two others proteins are part of the RNP, the polymerase (L, for large) and the phosphoprotein P, a polymerase cofactor. The viral polymerase transcribes the six MV genes into mRNAs in a sequential and polar manner (26). At each gene junction transcription is terminated and reinitiated, leading to the production of monocistronic mRNAs. When the polymerase complex does not stop at gene junctions, bicistronic or polycistronic mRNAs are produced (11). In the replicative mode, the polymerase complex never stops at gene junctions, producing complete copies of the viral genome.The P protein of Paramyxoviridae also has distinct functional domains (37). The carboxyl-terminal half is most conserved and c...

show abstract

A recombinant measles virus expressing biologically active human interleukin-12.

Cited by 59 publications

References 27 publications

Rescue of Mumps Virus from cDNA

Rescue of Mumps Virus from cDNA

Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication

Measles Virus Phosphoprotein Gene Products: Conformational Flexibility of the P/V Protein Amino-Terminal Domain and C Protein Infectivity Factor Function

Contact Info

Product

Resources

About