A Ready-to-Use Single- and Duplex-TaqMan-qPCR Assay to Detect and Quantify the Biocontrol Agents Trichoderma asperellum and Trichoderma gamsii

Abstract

Trichoderma asperellum strain icc012 and Trichoderma gamsii strain icc080, the microbial active ingredients of RemedierTM (ISAGRO, Novara, Italy), are biocontrol agents (BCAs) employable for crop protection against a wide range of fungal pathogens, including soil-borne pathogens and fungi involved in grapevine trunk disease. In this study, single and duplex real-time quantitative PCR (qPCR) methods to detect and quantify T. asperellum and T. gamsii were developed. Primers/probe sets were designed on the T. asperellum and T. gamsii rpb2 genes and tested for specificity on a panel of microorganisms commonly associated with grape wood and soil. No differences were observed comparing single- and duplex-qPCR assays on different BCAs, 1 pg of target DNA was detected approximately at Cq = 34. R2-values and the efficiency were always equal to 0.99 and >80%, respectively. The detection limit of the duplex-qPCR assay on artificially inoculated samples was 2 × 103 and 4 × 104 conidia g-1 of grape wood tissue and soil, respectively. The methods will be useful to better schedule BCA application in the field and in grapevine nurseries, as well as for investigating the dynamic of BCA populations.

Quantification of Trichoderma afroharzianum, Trichoderma harzianum and Trichoderma gamsii inoculants in soil, the wheat rhizosphere and in planta suppression of the crown rot pathogen Fusarium pseudograminearum

“…Consequently, molecular methods such as quantitative PCR (qPCR) have become important research tools for identifying and estimating inoculants in soil (Cordier et al 2007;Savazzini et al 2008;Gerin et al 2018). Yet, reports on detection of fungal biomass in plant roots have generally been limited to root endophytes (Lievens et al 2006;Edel-Hermann et al 2011) or plant pathogens (Tellenbach et al 2010;Jim enez-Fern andez et al 2011).…”

“…However, the number of repeats of multicopy rDNA subunits is known to vary within and between fungal species (Herrera et al 2009), making species identification difficult when based solely on ITS sequences (Hagn et al 2006). The singlecopy ribosomal polymerase B gene (rpb2) has recently been used in duplex qPCR to quantify T. asperellum and T. gamsii in soil and grapevine wood (Gerin et al 2018). Similarly, low copy-number SCAR markers developed from RAPDs have been applied to monitor populations of T. harzianum in field soils (Rubio et al 2005) and to differentiate a biological control strain of T. atroviride from other closely related species (Hermosa et al 2001;Cordier et al 2007;Savazzini et al 2008;Feng et al 2011).…”

Commercial Formulates of Trichoderma Induce Systemic Plant Resistance to Meloidogyne incognita in Tomato and the Effect Is Additive to That of the Mi-1.2 Resistance Gene

“…The detection and quantification of T. asperellum in tomato roots and in M10.23 and M10.55 soils were estimated using the TaqMan-quantitative PCR (qPCR) protocol specifically designed for this fungus by Gerin et al (2018). Root colonization of plants grown in the M10.23 and M10.55 soils was estimated from three biological replicates per treatment.…”

“…All DNA samples were quantified using Qubit dsDNA BR assay kit (Thermo Fisher Scientific). qPCR reactions were performed using the Sso AdvancedTM Universal Probes Supermix (Bio-Rad Laboratories, Hercules, CA, United States) in a final volume of 20 µl containing 40 ng of total DNA, 250 nM of each primer (5 to 3 direction) Ta_rpb2_fw (GGAGGTCGTTGAGGAGTACGAA) and Ta_rpb2_rev_3 (TTGCAGATAGGATTTACGACGAGT) and 150 nM of Ta_rpb2_probe (FAM-CGCTGAGGTATCCCCATGCGACA-BHQ1) (Gerin et al, 2018). Negative controls containing sterile water instead of DNA were included.…”

“…The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb. 2019.03042/full#supplementary-material TABLE S1 | Threshold cycle (Ct) values, were obtained for quantifying T. asperellum using the primers and probe designed by Gerin et al (2018) for every sample and technical replicates. The detection was carried out from roots of the susceptible tomato cv.…”