A re-evaluation of conflicting taxonomic structures of EurasianTriaenophorusspp. (Cestoda, Bothriocephalidea: Triaenophoridae) based on partialcox1mtDNA and 28S rRNA gene sequences

Abstract

Cestodes of the genus Triaenophorus Rudolphi, 1793 are widely distributed parasites of Esocidae, Percidae, Salmonidae, Thimallidae, Cobitidae, Osmeridae, Cyprinidae, Cottiidae, Lotidae, and several others in the Holarctic. The taxonomic arrangements of different authors, based on morphological and ecological–biogeographic characters, suggest the presence of two to five species of this genus in Eurasia. The genetic variation of Eurasian Triaenophorus spp. was evaluated using DNA barcoding ( cox1 and 28S gene sequences). This confirmed the validity of five Triaenophorus species: T. amurensis, T. crassus, T. meridionalis, T. nodulosus, and T. orientalis. We demonstrated systematic concordance between traditional meristic criteria and DNA sequence data. Phylogenetic reconstructions support the monophyletic origin of the group of species with a long basal plate of the scolex hook ( T. crassus, T. meridionalis, and T. orientalis). Triaenophorus crassus is represented by two haplogroups, associated with Siberia and northwestern Russia. Our results show differences between T. nodulosus, T. amurensis, and T. crassus in terms of the haplotype diversity level, which are probably related to the Quaternary history of the development of their ranges, as well as the degree of euryxeny to the second intermediate host.

Trophic diversification and parasitic invasion as ecological niche modulators for gut microbiota of a sympatric pair of whitefish

“…To determine the species of cestodes, partial sequences of the nuclear large subunit of rRNA gene (28S) were amplified using primers LSU5 (TAGGTCGACCCGCTGAAYTTYAGCA) and 1500R (GCTATCCTGAGGGAAACTTCG) (Littlewood et al, 2000(Littlewood et al, , 2008. PCR conditions and sequencing is described in Vlasenko et al (2022). Sequences were deposited into GenBank (NCBI) under the following accession numbers: SUB11262576 ON133796-ON133802.…”

Metapopulation Structure of Two Species of Pikeworm (Triaenophorus, Cestoda) Parasitizing the Postglacial Fish Community in an Oligotrophic Lake

“…According to a recent study based on sequencing of partial cox1 mtDNA and nuclear 28S rRNA genes, the Eurasian pikeworm Triaenophorus spp. consists of five valid species (T. amurensis Kuperman, 1968; T. crassus Forel, 1868; T. meridionalis Kuperman, 1968; T. nodulosus Pallas, 1781, Rudolphi, 1793; and T. orientalis Kuperman, 1968) [5]. The life cycle of these cestodes is complex and proceeds with the passage through two intermediate hosts and one definitive host.…”

“…Infestations with plerocercoids and adults of different Triaenophorus species are particularly common in freshwater fishes. The geographic distribution of the Triaenophorus species are circumpolar and includes more than 70 fish species that have been described as possible second intermediate and definitive hosts [5][6][7]. For freshwater bodies of West Siberia (Russia), two species, T. crassus and T. nodulosus, are of epizootic importance.…”

“…T. crassus and T. nodulosus differ in morphological features and localization in the second intermediate hosts. The main morphological differences of T. crassus from T. nodulosus are the shape of the scolex hooks, which have a massive basal part and small straight prongs [5,6]. The number of second intermediate hosts for T. crassus is much lower than for T. nodulosus; some hosts are common to both species.…”

“…Several fish species inhabiting Teletskoye Lake (Altai Republic, Western Siberia, Russia) are known as common hosts for these two Triaenophorus species. Thus, T. nodulosus is commonly found in the liver of Siberian sculpin Cottus sibiricus Kessler, 1889; perch Perca fluviatilis Linnaeus, 1758; arctic grayling Thymallus arcticus Pallas, 1776; and burbot Lota lota Linnaeus, 1758 [5,8]. While T. crassus typically parasitizes muscle tissue of a sympatric pair of coregonid whitefishes-the planktivorous "dwarf" form/species named Coregonus lavaretus pravdinellus Dulkeit, 1949 and the benthivorous "normal" form/species named Cor.…”