A protocol specialized for microbial DNA extraction from living poplar wood

Abstract

Microbial DNA extraction is a critical step in metagenomic research. High contents of chemical substances in wood tissues always cause low microbial DNA yield and quality. Up to date, almost no specialized methods involved in microbial DNA extraction from living wood were reported. In this study, an improved protocol (M1) concerning microbial DNA extraction from living poplar wood was developed. We compared microbial DNA yield and quality by M1 with those by other seven methods, including PowerSoil DNA isolation kit (M2), two soil microbial DNA extraction methods (M3 and M4), poplar genomic DNA extraction method from wood (M5), and microbial DNA extraction method from herb stems (M6), isolating bacteria (M7) and isolating fungus (M8). Results showed that M1 yielded much better quality and concentration of microbial DNA than the other methods (M2-M8) from both poplar wetwood and sapwood tissues. Following M1 protocol, 1 g of wetwood sample could yield 272.27 ng/ul (vol=50 ul) pure microbial DNA with the absorption ratios of 1.87 (A260/A230) and 1.66 (A260/A280). For 1 g of sapwood sample, these values were 361.83 ng/ul, 1.85 and 2.24, respectively. These DNA could be stably visualized by agarose gel electrophoresis and amplified by primer sets of bacteria (16S V3-V4, 16S-V4, 16S V4-V5) and fungus (ITS1, ITS2). While, the other seven methods only obtained less or contaminated microbial DNA, which could not be amplified stably by aforementioned primer sets. Our protocol provided an approach for microbial community study in living poplar wood in a more accurate way by molecular biology techniques.

Contribution to the characterization of the seed endophyte microbiome of Argania spinosa across geographical locations in Central Morocco using metagenomic approaches

“…Bacterial community structure was determined by sequencing the V3–V4 variable region of the 16S rRNA gene. Libraries were prepared according to the 16S metagenomic sequencing library preparation protocol (Illumina) using the primer pair 16SV3V4F (5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG- 3′) and 16SV3V4R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC- 3′) with an average fragment length of 460 bp under the following conditions: 98°C for 30 s, followed by 25 cycles of 98°C (10 s), 55°C (30 s), and 72°C (30 s), with a final extension at 72°C (10 min) ( Amplicon et al, 2013 ; Yu et al, 2022 ). The fungal community was also determined by sequencing ITS2 using a wide range of primers: ITS3_KYO1_Illumina (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAHCGATGAAGAACRYAG-3′) ( Toju et al, 2012 ) and ITS4_Illumina (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATAT GC- 3′) ( Toju et al, 2012 ) with an average fragment length of 300–350 bp under the following conditions: 98°C for 30 s, followed by 25 cycles of 98°C (10 s), 53°C (30 s), and 72°C (30 s), with a final extension at 72°C (10 min).…”