A primer set for the rapid isolation of scFv fragments against cell surface antigens from immunised rats

Abstract

Antibody phage display is a powerful platform for discovery of clinically applicable high affinity monoclonal antibodies against a broad range of targets. Libraries generated from immunized animals offer the advantage of in vivo affinity-maturation of V regions prior to library generation. Despite advantages, few studies have described isolation of antibodies from rats using immune phage display. In our study, we describe a novel primer set, covering the full rat heavy chain variable and kappa light chain variable regions repertoire for the generation of an unbiased immune libraries. Since the immune repertoire of rats is poorly understood, we first performed a deep sequencing analysis of the V(D)J regions of VH and VLK genes, demonstrating the high abundance of IGVH2 and IGVH5 families for VH and IGVLK12 and IGVLK22 for VLK. The comparison of gene’s family usage in naïve rats have been used to validate the frequency’s distribution of the primer set, confirming the absence of PCR-based biases. The primers were used to generate and assemble a phage display library from human CD160-vaccinated rats. CD160 represents a valid therapeutic target as it has been shown to be expressed on chronic lymphocytic leukaemia cells and on the surface of newly formed vessels. We utilised a novel phage display panning strategy to isolate a high affinity pool (KD range: 0.399–233 nM) of CD160 targeting monoclonal antibodies. Subsequently, identified binders were tested for function as third generation Chimeric Antigen Receptors (CAR) T cells demonstrating specific cytolytic activity. Our novel primer set coupled with a streamlined strategy for phage display panning enable the rapid isolation and identification of high affinity antibodies from immunised rats. The therapeutic utility of these antibodies was demonstrated in CAR format.

Oncolytic Adenoviral Vector-Mediated Expression of an Anti-PD-L1-scFv Improves Anti-Tumoral Efficacy in a Melanoma Mouse Model

“…The use of scFvs can also promote a more potent and specific immune response against cancer. Indeed, the smaller size of the scFv overcomes some of the limitations (large size) and possible unwanted side-effects of the whole antibodies, such as non-specific activation of circulating lymphocytes due to prolonged half-life, and promotes more efficient tumor tissue penetration ( 32 ). In this work, we have expressed the scFv-anti-PD-L1 in Ad5Δ24.…”

Combining phage display with SMRTbell next-generation sequencing for the rapid discovery of functional scFv fragments

“…In previous experiments we identified 5 clonotypes through conventional phage display selection and screening of over 200 phage clones. 20 All clonotypes found through conventional screening methods were observed in the NGS data set. We observed that for each HCDR3 clonotype family, between 1 and 77 kappa variable (VK) clonotypes were present ( Figure 4).…”

“…37 Libraries were generated as previously described with a size of 1 × 10 6 and 1 × 10 8 for CD160 and CD123, respectively. 20 Bio panning was carried out on Strep-Tactin® (IBA) magnetic beads using inhouse generated proteins that incorporated a streptagII tag for direct capture from transfected HEK293T cells. After three rounds of biopanning, antigen binding tests from individual bacterial colonies were performed as previously described.…”

“…After three rounds of biopanning, antigen binding tests from individual bacterial colonies were performed as previously described. 20 PacBio SMRTbell™ library assembly DNA from various libraries was amplified using primers specific for the phagemid vector pHEN1 backbone (M13 Rev caggaaacagctatgac and M13 Fd3 gtcgtctttccagacgttagt).…”