A positive selection for plasmid loss inSaccharomyces cerevisiae using galactose-inducible growth inhibitory sequences

Kawahata, Miho; Amari, Shinji; Akada, Rinji

doi:10.1002/(sici)1097-0061(19990115)15:1<1::aid-yea335>3.0.co;2-9

Cited by 24 publications

(28 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recombinant yeast strains free of any foreign DNA but containing engineered yeast genes could be constructed in Kyokai No. 7 with the PGKp-YAP1 marker using the procedure reported for the AUR1 selectable marker Kawahata et al, 1999, to be published elsewhere).…”

Section: Discussionmentioning

confidence: 99%

Use of a YAP1 overexpression cassette conferring specific resistance to cerulenin and cycloheximide as an efficient selectable marker in the yeast Saccharomyces cerevisiae

Akada

Shimizu

Matsushita

et al. 2001

Yeast

Self Cite

View full text Add to dashboard Cite

Drug-resistance markers for yeast transformation are useful because they can be applied to strains without auxotrophic mutations. However, they are susceptible to technical difficulties, namely lower transformation efficiency and the appearance of drug-resistant mutants without the marker. To avoid these problems, we have constructed a phosphoglycerate kinase (PGK) promoter-driven YAP1 expression cassette, called PGKp-YAP1. Yeast cells containing PGKp-YAP1 were resistant to cycloheximide, a protein synthesis inhibitor, and also to cerulenin, a fatty acid synthesis inhibitor, but not to other drugs tested. The transformation efficiency of PGKp-YAP1 using cerulenin selection was comparable to that using a URA3 auxotrophic marker when low concentrations of cerulenin were used. Non-transformed drug-resistant colonies did appear on the low-concentration cerulenin plates. However, these non-transformed colonies could easily be identified, based on their cycloheximide sensitivity and/or their resistance to aureobasidin A to which the transformants were sensitive. Therefore, the dual drug resistance of PGKp-YAP1 could be used as an effective selection for PGKp-YAP1 recipient cells. The PGKp-YAP1 marker was used to disrupt the LYS2 gene and to transform an industrial yeast strain, indicating that this marker can be used for efficient and reliable gene manipulations in any Saccharomyces cerevisiae strain.

show abstract

Section: Discussionmentioning

confidence: 99%

Use of a YAP1 overexpression cassette conferring specific resistance to cerulenin and cycloheximide as an efficient selectable marker in the yeast Saccharomyces cerevisiae

Akada

Shimizu

Matsushita

et al. 2001

Yeast

Self Cite

View full text Add to dashboard Cite

show abstract

“…9) The marker consists of a galactose-inducible overexpression promoter and the GIN11 growth-inhibitory sequence. 14) Cells that lost the marker grew well on galactose, but cells that retained the marker did not, because of the growth inhibitory effect of GIN11 overexpression. This marker is dominant, and can therefore be used in most yeast strains, including industrial yeast strains, without the need for mutations that are required in traditional counter-selections.…”

mentioning

confidence: 99%

Self-cloning Yeast Strains Containing NovelFAS2Mutations Produce a Higher Amount of Ethyl Caproate in Japanese Sake

Aritomi

Hirosawa

Hoshida

et al. 2004

Bioscience, Biotechnology, and Biochemistry

Self Cite

View full text Add to dashboard Cite

Point mutation of Gly1250Ser (1250S) of the yeast fatty acid synthase gene FAS2 confers cerulenin resistance. This mutation also results in a higher production of the apple-like flavor component ethyl caproate in Japanese sake. We mutated the 1250th codon by in vitro site-directed mutagenesis to encode Ala (1250A) or Cys (1250C) and examined cerulenin resistance and ethyl caproate production. The mutated FAS2 genes were inserted into a binary plasmid vector containing a drug-resistance marker and a counter-selectable marker, GALp-GIN11M86. The plasmids were integrated into the wild-type FAS2 locus of a sake yeast strain, and the loss of the plasmid sequences from the integrants was done by growth on galactose plates, which is permissive for loss of GALp-GIN11M86. These counter-selected strains contained either the wild type or the mutated FAS2 allele but not the plasmid sequences, from which FAS2 mutant strains were selected by allele-specific PCR. The FAS2-1250C mutant produced a higher amount of ethyl caproate in sake than FAS2-1250S, while FAS2-1250A produced an ethyl caproate level intermediate between FAS2-1250S and the parental Kyokai no. 7 strain. Interestingly, these mutants only showed detectable cerulenin resistance. These 'self-cloning' yeast strains should be acceptable to the public because they can improve sake quality without the presence of extraneous DNA sequences.

show abstract

“…The amplified fragments were then inserted into pYES2/CT (Invitrogen, Carlsbad, CA), resulting in pYEScAbl. A AscI-NotI fragment containing the GAL promoter was amplified by PCR with primers GAL10SacI (aaagagctcatcgcttcgctgatta) and GALpASCNOT (ttttgcggccgccattggcgcgccttatattgaattttcaaaaattcttacttt) from p316GAL, 29) and inserted into the SacI and NotI sites of pRS316 to generate p316GALASC. A c-Abl fragment was amplified from pYEScAbl with primers ASCAbl-1 (ggcgcgccaatgcccaaccttttcg) and NOTAblc1 (tttgcggccgcctattgtttccccagctcc), and inserted into the AscI and NotI sites of p316GALASC to form p316GALASCAbl.…”

Section: Methodsmentioning

confidence: 99%

Screening of Drugs That Suppress Ste11 MAPKKK Activation in Yeast Identified a c-Abl Tyrosine Kinase Inhibitor

Kitagawa

Hashizume

Murakane

et al. 2007

Bioscience, Biotechnology, and Biochemistry

Self Cite

View full text Add to dashboard Cite

A positive selection for plasmid loss inSaccharomyces cerevisiae using galactose-inducible growth inhibitory sequences

Cited by 24 publications

References 24 publications

Use of a YAP1 overexpression cassette conferring specific resistance to cerulenin and cycloheximide as an efficient selectable marker in the yeast Saccharomyces cerevisiae

Use of a YAP1 overexpression cassette conferring specific resistance to cerulenin and cycloheximide as an efficient selectable marker in the yeast Saccharomyces cerevisiae

Self-cloning Yeast Strains Containing NovelFAS2Mutations Produce a Higher Amount of Ethyl Caproate in Japanese Sake

Screening of Drugs That Suppress Ste11 MAPKKK Activation in Yeast Identified a c-Abl Tyrosine Kinase Inhibitor

Contact Info

Product

Resources

About