A population association study of vitamin D receptor gene polymorphisms and haplotypes with the risk of systemic lupus erythematosus in a Chinese population

Abstract

The aim of the study is to investigate the association of vitamin D receptor (VDR) gene polymorphism, additional gene-gene interaction, and haplotype combination with systemic lupus erythematosus (SLE) risk. Pairwise linkage disequilibrium (LD) analysis was conducted using SNPstats. The association between four SNPs within VDR gene and SLE risk was investigated by logistic regression. Generalized multifactor dimensionality reduction (GMDR) was used to analyze the interaction among four SNPs. Four SNPs within VDR gene were selected for genotyping in this study, including rs2228570, rs1544410, rs7975232, and rs731236. The T allele of rs2228570 and the G allele of the rs1544410 were associated with increased MM risk, adjusted ORs (95%CI) were 1.61(1.25-2.11) and 1.78 (1.34-2.23), respectively. GMDR analysis suggested a significant two-locus model (P = 0.0010) involving rs1544410 and rs2228570, and in this model, the cross-validation consistency was 10/10, and the testing accuracy was 62.70%. The haplotype analysis indicated that the most common haplotype was rs1544410-A and rs7975232-G haplotype, the frequencies of which were 0.4701 and 0.5467 in case and control group. Haplotype containing the rs1544410-G and rs7975232-T alleles were associated with increased SLE risk, OR (95%CI) = 2.08 (1.47-2.72), P < 0.001. We found that rs2228570 and rs1544410 within VDR gene, their interaction and haplotype containing the rs1544410-G and rs7975232-T alleles were all associated with increased SLE risk.

Association between vitamin D receptor polymorphisms and systemic lupus erythematosus in an Indian cohort

“…The studies on the association of VDR polymorphism with SLE or is clinical severity have been inconsistent . However, in the present study, heterozygous variants and minor alleles of Fok I and Taq polymorphism were significantly associated with SLE, but no such link was noticed between Apa I and Bsm I with disease susceptibility.…”

“…However, in the present study, heterozygous variants and minor alleles of Fok I and Taq polymorphism were significantly associated with SLE, but no such link was noticed between Apa I and Bsm I with disease susceptibility. A recent report on a Chinese cohort showed association of Fok I variants (CT and TT) with susceptibility to SLE . However, reports including Taiwanese, Japanese and Han Chinese failed to demonstrate possible links between Bsm I variant with SLE susceptibility.…”

“…Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. Polymorphisms in the VDR gene were genotyped by polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (PCR‐RFLP) as performed earlier . In brief, the total reaction mixture was 20 μL including 10 picomole of each primer set ( Fok I: F‐5′‐GCACTGACTCTGGCTCTGAC‐3′, R‐5′‐ACCCTCCTGCTCCTGTGGCT‐3′, amplicon size 341 bp; Taq I: F‐5′‐TCCTGTGCCTTCTTCTCTATC‐3′, R‐5′‐CTAGCTTCTGGATCATCTTGG‐3′, amplicon size 172 bp; Bsm I: F‐5′‐GGAGACACAGATAAGGAAATAC‐3′, R‐5′‐CCGCAAGAAACCTCAAATAACA, amplicon size 248 bp; Apa I: F‐5′‐TGGGCACGGGGATAGAGAAG‐3′, R‐5′‐ACGGAGAAGTCACTGGAGGG‐3′, amplicon size 177 bp), 1 unit of Taq polymerase, 0.5 μL of 10 nm deoxynucleotide triphosphate mixture and 2 μL of genomic DNA.…”

Vitamin D levels and vitamin D receptor variants are associated with chronic heart failure in Chinese patients

“…As described earlier, vitamin D receptor polymorphisms ( FokI , TaqI , BsmI , and ApaI ) were genotyped by polymerase chain reaction followed by restriction fragment length polymorphism (PCR‐RFLP). Thermocycling condition for amplification of PCR fragment was as follows: initial denaturation for 5 minutes at 95°C, followed by 35 cycles of denaturation at 95°C for 40 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 45 seconds.…”

Significance of Gene Polymorphism of Vitamin D Receptor in Human Pathology

“…При этом ТТ-генотип был ассоциирован с более тяжелым течением заболевания по сравнению с СС-и ТС-вариантами [24]. Исследование TagI поли-морфизма гена VDR у взрослых, страдающих легочным туберкулезом, показало преобладание аллеля Т в груп-пе больных, соотношение генотипов ТТ, Тt и tt соста-вило соответственно 29, 45 и 26% [25].…”