A Polymerase Chain Reaction Assay for Detection of the Parasite Wuchereria bancrofti in Human Blood Samples

Abstract

To identify Wuchereria bancrofti DNA sequences that could be used as the basis for a simple and rapid parasite detection assay, a genomic library of W. bancrofti was constructed and screened for highly repeated DNA. The repeat found with the highest copy number was 195 basepairs (bps) long, 77% AT, and 300 copies per haploid genome. This sequence was designated the Ssp I repeat because it has a unique recognition site for that restriction endonuclease in all or most of the repeat copies. The Ssp I repeat DNA family is dispersed, genus-specific, and exists in all of the different geographic isolates of W. bancrofti tested. Based on DNA sequence analysis of this repeat, we have developed an assay to detect very small quantities of W. bancrofti DNA using the polymerase chain reaction (PCR). With this PCR assay, the Ssp I repeat was detected in as little as 1 pg of W. bancrofti genomic DNA (about 1% of the DNA in one microfilaria) added to 100 pA of human blood. The PCR assay also amplified Ssp I repeat DNA from geographic isolates of W. bancrofti from around the world but not from other species of filariae or from human or mosquito DNA. Microfilaria-positive human blood samples collected in Mauke, Cook Islands were shown to be Ssp I PCR-positive, while microfilaria-negative samples were PCR-negative. The specificity and sensitivity of the Ssp I PCR assay indicates that this approach has significant potential for improved screening of large human populations for active W. bancrofti infection.

Perfil protéico e reconhecimento antigênico de extratos de larvas infectantes (L3) de Wuchereria bancrofti

“…As lâminas foram coradas com hematoxilina pelo método de Carazzi e observadas em microscópio óptico com objetivas e oculares de 10x. 31 ; iv)Controle negativo: soro de amicrofilarêmicos, moradores de área não endêmica. As amostras de soro dos grupos foram aliquotadas (50µl de cada amostra de soro com as mesmas características clínicas) na forma de pool e assim empregadas na realização das reações imunoquímicas (Western-blot, imunofluorescência e dot-blot).…”

Immunodiagnosis of human lymphatic filariasis: A review

“…A polymerase Chain reaction (PCR) assay based on highly repeated DNA has been developed for the diagnosis of W.bancrofti infection (7). Studies have been shown that this assay is highly sensitive and can even detect single microfilaria in the blood samples from infected individuals.…”

Molecular Technique Utilising Sputum For Detecting <i>Wuchereria bancroft</i>i Infections In Malindi, Kenya

“…This was repeated for 35 cycles, before a further elongation step at 72 o C for ten minutes. The primer pair used in this study, forward 5' CGTGATGGCATAAAGTAGCG 3' and reverse 3' CCTCACTTACCATAAGACAAC 5'), were originally designed by Zhong, et al (9). They amplified 188bp fragment of W. bancrofti DNA sequence.…”