A physical map of the X chromosome of Drosophila melanogaster: cosmid contigs and sequence tagged sites.

Abstract

A physical map of the euchromatic X chromosome of Drosophila melanogaster has been constructed by assembling contiguous arrays of cosmids that were selected by screening a library with DNA isolated from microamplified chromosomal divisions. This map, consisting of 893 cosmids, covers approximately 64% of the euchromatic part of the chromosome. In addition, 568 sequence tagged sites (STS), in aggregate representing 120 kb of sequenced DNA, were derived from selected cosmids. Most of these STSs, spaced at an average distance of approximately 35 kb along the euchromatic region of the chromosome, represent DNA tags that can be used as entry points to the fruitfly genome. Furthermore, 42 genes have been placed on the physical map, either through the hybridization of specific probes to the cosmids or through the fact that they were represented among the STSs. These provide a link between the physical and the genetic maps of D. melanogaster. Nine novel genes have been tentatively identified in Drosophila on the basis of matches between STS sequences and sequences from other species.

ELAV, a Drosophila neuron-specific protein, mediates the generation of an alternatively spliced neural protein isoform

“…To clone the genomic region spanning the alternatively spliced exons from cosmids containing the nrg locus [38], oligonucleotides named OF1, SR2 and LR2 were synthesized using published sequences [13] to serve as probes for the common exon, the Nrg 167 -specific exon and Nrg 180 -specific exon, respectively. OF1 sequence: 5′ CGCTGGTCGCCAATCCGTGAGTTCAGCGAAC 3′ SR2 sequence:5′GCGCTGCTTACTAATTAAATCAAAGTCCTTTGCGTC 3′ LR2 sequence: 5′ TGATGCGCCGCAGCGGAATTGTTCAGTGGCTG 3′…”

“…The end-labeled oligonucleotides were used to screen, in Southern blots, a series of cosmids spanning the 7D to 7F region (Genome Mapping project, Institute of Molecular Biology and Biotechnology, Heraklion, Crete, Greece [38]). The probes hybridized to three overlapping cosmids, 168F4, 48C2, 1B2.…”

Genetic Analysis of Netrin Genes in Drosophila: Netrins Guide CNS Commissural Axons and Peripheral Motor Axons

“…NetB is expressed by many more neurons than NetA, in lateral patches in the epidermis, which subsequently A rough map showing the overlaps of physical clones. "T" refers to cosmids from the Tamkun library, "C" to cosmids from the Crete library (Madueno et al, 1995), "P1" to P1 clones from the BDGP, and "" to -clones. The contig on the left around the yolkless gene (yl ) was provided by C. Schonbaum.…”