A PCR-Elisa Procedure for the Simultaneous Detection and Identification of Prunus Necrotic Ringspot (Pnrsv) and Apple Mosaic (Apmv) Ilarviruses

Candresse, Thierry; Kofalvi, S. A.; Lanneau, M.; Dunez, Jean

doi:10.17660/actahortic.1998.472.23

Cited by 21 publications

(6 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RT‐PCR amplification of the 17 Ilarvirus isolates gave a product of approximately 670 bp with the ApMV primer set corresponding to the CP of ApMV. Tests using the PNRSV‐specific primers of Hammond & Crosslin (1998) failed to produce products, although in tests using the ApMV/PNRSV primer set of Candresse et al . (1998), PCR products of the expected size were amplified from all extracts from which the ApMV CP gene was amplified.…”

Section: Resultsmentioning

confidence: 99%

“…Extracts were also tested for the presence of PNRSV using virus‐specific and Ilarvirus‐ generic primer sets following the procedures of Hammond & Crosslin (1998) (specific PNRSV detection, upstream primer 5′‐CATCGACCAGCAAGACATCA‐3′, downstream primer 5′‐GTGGGTTTAGAGATTGTTGG‐3′) and Candresse et al . (1998) (simultaneous detection of PNRSV and ApMV, upstream primer 5′‐TTCTAGCAGGTCTTCATCGA‐3′, downstream primer 5′‐CAACCGAGAGGTTGGCA‐3′).…”

Section: Methodsmentioning

confidence: 99%

“…Sequence data comparisons of PNRSV and ApMV have shown significant areas of both similarity (Candresse et al ., 1998) and difference (Scott et al ., 1998) within the CP‐coding region. If antibodies binding to epitopes in the dissimilar areas were used in enzyme‐linked immunosorbent assay (ELISA) testing, the viruses would appear to be serologically unrelated, while antibodies binding in the similar areas would show them to be serologically related (Scott et al ., 1998).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Diversity of the coat protein‐coding region among Ilarvirus isolates infecting hop in Australia

Crowle

Pethybridge

Leggett³

et al. 2003

Plant Pathology

View full text Add to dashboard Cite

Coat protein (CP) sequences of 17 Ilarvirus isolates were obtained from hops at three farms in Tasmania, Australia. Phylogenetic analysis of these sequences and additional database sequences indicated several Apple mosaic virus (ApMV) isolate clusters distinct from Prunus necrotic ringspot virus (PNRSV): one containing isolates from apple; one containing a single isolate from almond; a third containing Australian hop isolates of the 'apple' serotype and a German isolate of unknown origin; and a fourth containing Australian hop isolates of the 'intermediate' serotype. Isolates from hop, pear and prune from the Czech Republic either formed a fifth grouping, or were divergent members of the 'intermediate' serotype group. Deduced amino acid (aa) residue differences between the coat proteins of the two hop isolate serotype groups were highlighted as possible regions of serological differentiation. No evidence for coinfection of plants with both serotypes was found. Tests of ApMV-infected hop buds using the Shirofugen flowering cherry assay revealed a possible differentiation of the two strains based on hypersensitivity. Because of serological similarities to PNRSV, these viruses have commonly been reported as strains of PNRSV. However, this study shows ilarviruses from Australian hops are strains of ApMV, but distinct from those infecting Malus spp.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Diversity of the coat protein‐coding region among Ilarvirus isolates infecting hop in Australia

Crowle

Pethybridge

Leggett³

et al. 2003

Plant Pathology

View full text Add to dashboard Cite

show abstract

“…In the same conditions, total RNA prepared from leaf tissues and clarified crude extracts gave weak detectable product. There are sufficient reports on the detection of ApMV directly from its other hosts and indicator plants by different kind of PCR methods (Candresse et al, 1998;Saade et al, 2000;Menzel et al, 2002;Petrzik and Lenz, 2002;Choi and Ryu, 2003;Crowle et al, 2003;Hassan et al, 2006). However, there is none directly from hazelnut tissues.…”

Section: Discussionmentioning

confidence: 99%

Simultaneous detection of Apple mosaic virus in cultivated hazelnuts by one-tube RT-PCR

Akbaş¹,

Deği̇rmenci̇²

2010

Afr. J. Biotechnol.

View full text Add to dashboard Cite

The most economically damaging ilarvirus affecting hazelnut on a worldwide scale is the related apple mosaic virus (ApMV). Attempts were made to isolate the virus RNA from hazelnut tissues using different extraction methods. The most suitable extraction method that could detect the virus occurring naturally in hazelnut by reverse-transcription polymerase chain reaction (RT-PCR) methodology was selected. RT-PCR was applied successfully using flower, husk and leaf tissues. The most suitable extraction method and hazelnut tissues determined were sensitive, simple, rapid and reliable for simultaneous detection of ApMV in hazelnut tissues. To our knowledge, this is the first report of the simultaneous detection of the virus by RT-PCR, an alternative detection of ApMV in hazelnut hosts.

show abstract

“…The primers used for reverse transcription (RT) PCR and quantitative RT‐PCR (RT‐qPCR) are listed in Table . Primer pairs ASGV‐U/ASGV‐2 (James, 1999), ASPV‐sense/ASPV‐antisense (Menzel et al, 2002), 3‐F/3‐R (Liu et al, 2020), ILAR1/ILAR2 (Candresse et al, 1998), ALuDetF6/ALuDetR6 (Liu et al, 2018), ALSV‐F/ALSV‐R (Izuishi et al, 2020), ARWaV‐1L4842F/ARWaV‐1L5230R (Rott et al, 2018), SF/SR (Wang et al, 2019), ApNMV‐CP+1/ApNMV‐CP‐1 (Noda et al, 2017), 355F/898R (James et al, 2013), 25‐mer/16‐mer (Hadidi et al, 1990), RF‐1385/RF‐1386 (Serra et al, 2018), apscarviroids‐F/apscarviroids‐R (degenerate primers) (Sano et al, 2000), AFCVd‐PCR‐FOR/AFCVd‐PCR‐REV (Matoušek et al, 2017), and HSVd‐PCR‐FOR/HSVd‐PCR‐REV (Matoušek et al, 2017) for RT‐PCR detection of ASGV, ASPV, PCLSaV, ApMV, apple luteovirus 1 (ALV‐1), ALSV, apple rubbery wood virus 1 (ARWV1), ARWV2, apple necrotic mosaic virus (ApNMV), apple green crinkle associated virus (AGCaV), ASSVd, apple hammerhead viroid (AHVd), apple dimple fruit viroid (ADFVd), apple fruit crinkle viroid (AFCVd), and hop stunt viroid (HSVd), respectively, were previously reported.…”

Section: Methodsmentioning

confidence: 99%

Incidence of major pome fruit tree viruses and viroids in commercial pear orchards in China and in Pyrus betulifolia seedlings

Huang

et al. 2021

Plant Pathology

View full text Add to dashboard Cite

Latent viral infections are common in pome fruit trees, including apple, pear, and quince, leading to significant reductions in yield and quality (reviewed by Umer et al., 2019). Twenty-one viruses, belonging to 12 genera classified into nine families, have been identified to infect pome fruit trees (Umer et al., 2019). In addition, a novel virus, provisionally named pear chlorotic leaf spot-associated virus (PCLSaV), has been recently identified in pear trees in China (Liu et al., 2020). Among them, apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), apple chlorotic leaf spot virus (ACLSV), and apple mosaic virus (ApMV) are considered the most economically important viruses affecting pome fruit trees worldwide. In

show abstract

A PCR-Elisa Procedure for the Simultaneous Detection and Identification of Prunus Necrotic Ringspot (Pnrsv) and Apple Mosaic (Apmv) Ilarviruses

Cited by 21 publications

References 0 publications

Diversity of the coat protein‐coding region among Ilarvirus isolates infecting hop in Australia

Diversity of the coat protein‐coding region among Ilarvirus isolates infecting hop in Australia

Simultaneous detection of Apple mosaic virus in cultivated hazelnuts by one-tube RT-PCR

Incidence of major pome fruit tree viruses and viroids in commercial pear orchards in China and in Pyrus betulifolia seedlings

Contact Info

Product

Resources

About