A pair of G‐type lectin receptor‐like kinases modulates nlp20‐mediated immune responses by coupling to the RLP23 receptor complex

Abstract

Plant cells recognize microbial patterns with the plasma-membrane-localized pattern-recognition receptors consisting mainly of receptor kinases (RKs) and receptor-like proteins (RLPs). RKs, such as bacterial flagellin receptor FLS2, and their downstream signaling components have been studied extensively. However, newly discovered regulatory components of RLP-mediated immune signaling, such as the nlp20 receptor RLP23, await identification. Unlike RKs, RLPs lack a cytoplasmic kinase domain, instead recruiting the receptor-like kinases (RLKs) BAK1 and SOBIR1. SOBIR1 specifically works as an adapter for RLP-mediated immunity. To identify new regulators of RLPmediated signaling, we looked for SOBIR1-binding proteins (SBPs) in Arabidopsis thaliana using protein immunoprecipitation and mass spectrometry, identifying two G-type lectin RLKs, SBP1 and SBP2, that physically interacted with SOBIR1. SBP1 and SBP2 showed high sequence similarity, were tandemly repeated on chromosome 4, and also interacted with both RLP23 and BAK1. sbp1 sbp2 double mutants obtained via CRISPR-Cas9 gene editing showed severely impaired nlp20induced reactive oxygen species burst, mitogenactivated protein kinase (MAPK) activation, and defense gene expression, but normal flg22-induced immune responses. We showed that SBP1 regulated nlp20-induced immunity in a kinase activityindependent manner. Furthermore, the nlp20induced the RLP23-BAK1 interaction, although not the flg22-induced FLS2-BAK1 interaction, was significantly reduced in sbp1 sbp2. This study identified SBPs as new regulatory components in RLP23 receptor complex that may specifically modulate RLP23-mediated immunity by positively regulating the interaction between the RLP23 receptor and the BAK1 co-receptor.

A plant cell death-inducing protein from litchi interacts with Peronophythora litchii pectate lyase and enhances plant resistance

“…3e, f ). Furthermore, we generated atpip1 mutants in Arabidopsis thaliana using CRISPR/Cas9-mediated genome editing 41 . Single nucleotide insertions or a 10-nucleotide deletion in AtPIP1 exons resulted in premature stop codons, leading to loss of AtPIP1 function (Supplementary Fig.…”

“…To knockout AtPIP1 ( AT5G58375 ), the CRISPR/Cas9-mediated genome-editing method was used 41 with sgRNA (sg- AtPIP1 : CATATTCCTTTCAGCGACTC). The genotypes of the transgenic plants were analyzed by PCR and Sanger sequencing using DNA extracted from transgenic plants as template, and primers used for these analyses are listed in Supplementary Data 4 .…”

Plant immune receptors interact with hemibiotrophic pathogens to activate plant immunity

“…Among them, the OsLecRK mutant is more susceptible to Magnaporthe grisea infection than the wild type, with a reduction in mRNA levels of PR1 , LOX2 , and CHS defense-related genes ( Cheng et al, 2013 ). Similar to LRR receptors, G-type SBP1 and SBP2 can specifically activate immunity by positively regulating the interaction between RLP23 receptors and BAK1 co-receptors ( Bao et al, 2023 ). G-type LecRK LORE was identified as a target site for the effector HopAO1 of P. syringae .…”

LORE receptor homomerization is required for 3‐hydroxydecanoic acid‐induced immune signaling and determines the natural variation of immunosensitivity within the Arabidopsis genus

“…Apart from SRKs, only a few SD‐RLKs have been described in more detail. They are involved in plant–pathogen interactions and symbiosis or abiotic stress responses (Walker & Zhang, 1990; Tobias et al ., 1992; Tobias & Nasrallah, 1996; Chen et al ., 2006, 2013; Kim et al ., 2009a,b; Gilardoni et al ., 2011; Cheng et al ., 2013; X. L. Sun et al ., 2013; Trontin et al ., 2014; Ranf et al ., 2015; Zou et al ., 2015; Fan et al ., 2018; Schnepf et al ., 2018; Kutschera et al ., 2019; Labbé et al ., 2019; Park et al ., 2019; Jinjun et al ., 2020; Pan et al ., 2020; Sun et al ., 2020; Liu et al ., 2021; Mondal et al ., 2021; Schellenberger et al ., 2021; Kato et al ., 2022; Ma et al ., 2022; Bao et al ., 2023; Pi et al ., 2023; Shrestha et al ., 2023; Zhou et al ., 2023). Although a growing number of members of the large SD‐RLK sub‐family are being characterized, their ligands, receptor complex formation, and downstream signaling mechanisms remain largely unknown.…”