A nuclease-assisted label-free aptasensor for fluorescence turn-on detection of ATP based on the in situ formation of copper nanoparticles

Song, Quanwei; Wang, Ruihua; Sun, Feifei; Chen, Hongkun; Wang, Zoumengke; Na, Na; Ouyang, Jin

doi:10.1016/j.bios.2016.09.029

Cited by 75 publications

(27 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The 5′‐amino‐modified DNA oligonucleotides (5′‐TTTTTTACCTGGGGGAGTATTGCGGAGGAAGG‐3′ for ATP aptamer and its complementary strand 5′‐CCTTCCTCCGCAATACTCCCCCAGGTAAAAAA‐3′) with a C6 spacer arm were synthesized by Oligo Macrogen (Seoul, South Korea). Ammonium hydroxide (25%, w/w), ferric chloride hexahydrate (FeCl 3 .6H 2 O), ferrous chloride tetrahydrate (FeCl 2 ·4H 2 O), NaCl, KCl, KH 2 PO 4 , Na 2 HPO 4 , and glutaraldehyde (GA; 25% solution in water) were purchased from Riedel‐DeHaan (Seelzet, Germany).…”

Section: Methodsmentioning

confidence: 99%

“…To date, different analytical methods have been reported for ATP analysis, including electrochemical assays, chromatography, electrochemiluminescence assays, or fluorescence biosensing, etc. Among these analytical methods, fluorescence applications have been widely implemented to develop biosensors due to their simplicity, sensitivity and real‐time detection .…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

A fluorescent aptasensor for analysis of adenosine triphosphate based on aptamer–magnetic nanoparticles and its single‐stranded complementary DNA labeled carbon dots

2018

View full text Add to dashboard Cite

A new fluorimetric aptasensor was designed for the determination of adenosine triphosphate (ATP) based on magnetic nanoparticles (MNPs) and carbon dots (CDs). In this analytical strategy, an ATP aptamer was conjugated on MNPs and a complementary strand of the aptamer (CS) was labeled with CDs. The aptamer and its CS were hybridized to form a double helical structure. The hybridized aptamers could be used for the specific recognition of ATP in a biological complex matrix using a strong magnetic field to remove the interfering effect. In the absence of ATP, no CDs-CS could be released into the solution and this resulted in a weak fluorescence signal. In the presence of ATP, the target binds to its aptamer and causes the dissociation of the double helical structure and liberation of the CS, such that a strong fluorescence signal was generated. The increased fluorescence signal was proportional to ATP concentration. The limit of detection was estimated to be 1.0 pmol L with a dynamic range of 3.0 pmol L to 5.0 nmol L . The specific aptasensor was applied to detect ATP in human serum samples with satisfactory results. Moreover, molecular dynamic simulation (MDS) studies were used to analyze interactions of the ATP molecule with the aptamer.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

A fluorescent aptasensor for analysis of adenosine triphosphate based on aptamer–magnetic nanoparticles and its single‐stranded complementary DNA labeled carbon dots

2018

View full text Add to dashboard Cite

show abstract

“…However, DNA‐hosted copper nanoparticles (CuNPs), a new nanomaterial, show great promise because they have low toxicity, outstanding photophysical properties, good biocompatibility, and are simple and quick to synthesize compared with AgNCs. Double‐strand DNA (dsDNA) and single‐strand DNA poly(thymine) have been used to efficiently synthesize CuNPs that are useful in biological detection . Considering the sequence‐dependent growth of CuNPs in DNA, a special double‐strand consecutive adenine/thymine (AT) sequence was explored to act as a better scaffold .…”

Section: Methodsmentioning

confidence: 99%

“…Double-strandDNA (dsDNA)a nd single-strand DNA poly(thymine) have been used to efficientlys ynthesize CuNPs that are useful in biological detection. [17][18][19][20] Considering the sequence-dependent growth of CuNPs in DNA, as pecial double-strand consecutive adenine/thymine (AT) sequence was explored to act as ab etter scaffold. [21,22] The distinctive AT-rich DNA sequence has greatp otentialf or the design of templates for CuNPs.T he DNA three-way junction (3WJ), which is constructed when three helicesm eet at one point, is an excellent multifunctional platform for nanostructures.…”

mentioning

confidence: 99%

DNA Three‐Way Junction for Differentiation of Single‐Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles

Sun

You

Liu

et al. 2017

Chemistry A European J

Self Cite

View full text Add to dashboard Cite

A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples.

show abstract

“…Dyes, such as PicoGreen [ 25 , 26 ], thiazole orange (TO) [ 27 ], and SYBR Green I [ 28 ], intercalate in double-stranded DNA to produce fluorescence, but do not fluoresce in single strands of DNA. Thioflavin T dye forms an G-quadruplex complex with the G-rich aptamer and results in high fluorescence signal [ 29 , 30 ]. These dyes have the advantages of being simple, rapid to use, and low in cost.…”

Section: Introductionmentioning

confidence: 99%

A Label-Free Fluorescent AND Logic Gate Aptasensor for Sensitive ATP Detection

Zhang

Yang

Niu

et al. 2018

Sensors

View full text Add to dashboard Cite

In this study, a label-free fluorescent, enzyme-free, simple, highly sensitive AND logic gate aptasensor was developed for the detection of adenosine triphosphate (ATP). Double-stranded deoxyribonucleic acid (DNA) with cohesive ends was attached to graphene oxide (GO) to form an aptasensor probe. ATP and single-stranded DNA were used as input signals. Fluorescence intensity of PicoGreen dye was used as an output signal. The biosensor-related performances, including the logic gate construction, reaction time, linearity, sensitivity, and specificity, were investigated and the results showed that an AND logic gate was successfully constructed. The ATP detection range was found to be 20 to 400 nM (R2 = 0.9943) with limit of detection (LOD) of 142.6 pM, and the sensitivity range was 1.846 × 106 to 2.988 × 106 M−1. This method for the detection of ATP has the characteristics of being simple, low cost, and highly sensitive.

show abstract

A nuclease-assisted label-free aptasensor for fluorescence turn-on detection of ATP based on the in situ formation of copper nanoparticles

Cited by 75 publications

References 26 publications

A fluorescent aptasensor for analysis of adenosine triphosphate based on aptamer–magnetic nanoparticles and its single‐stranded complementary DNA labeled carbon dots

A fluorescent aptasensor for analysis of adenosine triphosphate based on aptamer–magnetic nanoparticles and its single‐stranded complementary DNA labeled carbon dots

DNA Three‐Way Junction for Differentiation of Single‐Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles

A Label-Free Fluorescent AND Logic Gate Aptasensor for Sensitive ATP Detection

Contact Info

Product

Resources

About