A novel spontaneous missense mutation in VMD2 gene is a cause of a Best macular dystrophy sporadic case

Palomba, Grazia; Rozzo, Carla; Angius, Andrea; Pierrottet, Chiara O.; Orzalesi, N.; Pirastu, Mario

doi:10.1016/s0002-9394(99)00327-x

Cited by 13 publications

(4 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…3,4,13 We observed a novel de novo mutation in a single member of a family whose parents were both clinically and electrophysiologically unaffected and did not show a mutation in the VMD2 gene. Our findings, in addition to those of one other report, 11 have implications for the diagnosis and genetic counseling of an isolated member of a family with a vitelliform-like macular lesion. These results also suggest that de novo mutations in the VMD2 gene may occur more frequently than might previously have been anticipated.…”

Section: Commentsupporting

confidence: 75%

See 1 more Smart Citation

Novel De Novo Mutation in a Patient With Best Macular Dystrophy

Apushkin¹

2006

Arch Ophthalmol

View full text Add to dashboard Cite

show abstract

Section: Commentsupporting

confidence: 75%

“…9,10 To our knowledge, only 1 spontaneous VMD2 gene mutation has been reported previously (exon 6, C221W). 11 This mutation was observed in a 4-year-old girl whose parents did not show any evidence of a carrier state on funduscopy or genetically. Electrophysiologic findings were not reported for either of the 2 par-ents.…”

mentioning

confidence: 95%

Novel De Novo Mutation in a Patient With Best Macular Dystrophy

Apushkin¹

2006

Arch Ophthalmol

View full text Add to dashboard Cite

show abstract

“…1 In these cases, the unaffected family members carry only one of the heterozygous mutations. While over 100 different BEST1 mutations have been CCATGGCCCCTCTAATTTCT 363 2 GAGGTCCAGAGCAGGGAAGGGT CAGCCCCAGCCACATCCTT 327 3 GAGGCAGTCCCACTCCTACC GCAGCTCCTCGTGATCCTC 278 4 CTCCTGCCCAGGCTTCTACGT CCACCCATCTTCCATTCCT 326 5 GGTTCCTATAGGTCAGCAGGTG GAAACCTTGTTTCCTGTGGAC 303 6 TGGTACCTGGAGAAGAGGTG CCTTGGTCCTTCTAGCCTCA 219 7 CATCCTGATTTCAGGGTTCC GACACTGCATCCTCGTCTCA 298 8 ATGGGGTGTGGAAATAGCAG GAGGGGAAGGGTTGATCATT 290 9 CTCCAAGTCATCAGGCACAT GCAGACCCCTGCACTAGGAG 284 10-1 GGTGTTGGTCCTTTGTCCAC TGACACTGTGAAGCTTTGACG 430 10-2 CTGGAAGCTTAAGGCTGTGG TAGGCTCAGAGCAAGGGAAG 481 11 CTTTGCCCTCCTACTGCAAC TCCTTAAGTGCCGTTGTTCA 487 described in families affected by Best disease, [13][14][15][16][17] only a few combinations of compound heterozygous mutations in arBVMD have been reported. [1][2][3][4][5]11 In our study, the affected children were found to have a combination of two heterozygous mutations: c.122T4C (L41P) and c. 602T4C (I201T).…”

Section: Discussionmentioning

confidence: 99%

A novel compound heterozygous mutation in the BEST1 gene causes autosomal recessive Best vitelliform macular dystrophy

Zhao

Grob

Corey

et al. 2012

Eye

View full text Add to dashboard Cite

Purpose To determine the genetic basis of early onset autosomal recessive Best vitelliform macular dystrophy (arBVMD) in a family with three affected children. Design Clinical and family-based genetic study. Methods Seven subjects making up a family with three children affected by Best vitelliform macular dystrophy were studied. Standard ophthalmic exam with dilated ophthalmoscopy and imaging were performed in each individual. The eleven exons of BEST1 were directly sequenced. Results All three affected children have the clinical characteristic features of Best vitelliform macular dystrophy: large macular vitelliform lesions, scattered vitelliform lesions along the arcades and in the peripheral retina, and an accumulation of serous retinal fluid. A novel compound heterozygous mutation in the BEST1 gene was found in the three affected individuals (L41P and I201T). The unaffected parents and children only harbor one heterozygous mutation. Conclusion arBVMD can be caused by the compound heterozygous mutation L41P and I201T in the BEST1 gene.

show abstract

“…At least 79 different bestrophin mutations have been found in BMD patients (125) (summarized at the VMD2 mutation data base, www.uni-wuerzburg.de/humangenetics/vmd2.html). These include missense, single amino acid deletions, as well as splice site and frameshift mutations (6,13,28,46,104,118,123,126,144,148). Bestrophins share homology with the Caenorhabditis elegans RFP gene family, named for the presence of a conserved RFP amino acid sequence motif which is found in 26 transmembrane proteins with related sequences grouped in worm family eight (170).…”

Section: Clca Bestrophins and Retinopathymentioning

confidence: 99%

Structure and Function of CLCA Proteins

Loewen¹,

Forsyth²

2005

Physiological Reviews

118

126

View full text Add to dashboard Cite

CLCA proteins were discovered in bovine trachea and named for a calcium-dependent chloride conductance found in trachea and in other secretory epithelial tissues. At least four closely located gene loci in the mouse and the human code for independent isoforms of CLCA proteins. Full-length CLCA proteins have an unprocessed mass ratio of ∼100 kDa. Three of the four human loci code for the synthesis of membrane-associated proteins. CLCA proteins affect chloride conductance, epithelial secretion, cell-cell adhesion, apoptosis, cell cycle control, mucus production in asthma, and blood pressure. There is a structural and probable functional divergence between CLCA isoforms containing or not containing β4-integrin binding domains. Cell cycle control and tumor metastasis are affected by isoforms with the binding domains. These isoforms are expressed prominently in smooth muscle, in some endothelial cells, in the central nervous system, and also in secretory epithelial cells. The isoform with disrupted β4-integrin binding (hCLCA1, pCLCA1, mCLCA3) alters epithelial mucus secretion and ion transport processes. It is preferentially expressed in secretory epithelial tissues including trachea and small intestine. Chloride conductance is affected by the expression of several CLCA proteins. However, the dependence of the resulting electrical signature on the expression system rather than the CLCA protein suggests that these proteins are not independent Ca2+-dependent chloride channels, but may contribute to the activity of chloride channels formed by, or in conjunction with, other proteins.

show abstract

A novel spontaneous missense mutation in VMD2 gene is a cause of a Best macular dystrophy sporadic case

Cited by 13 publications

References 3 publications

Novel De Novo Mutation in a Patient With Best Macular Dystrophy

Novel De Novo Mutation in a Patient With Best Macular Dystrophy

A novel compound heterozygous mutation in the BEST1 gene causes autosomal recessive Best vitelliform macular dystrophy

Structure and Function of CLCA Proteins

Contact Info

Product

Resources

About