A Novel Rickettsia Species Detected in Vole Ticks (Ixodes angustus) from Western Canada

Anstead, Clare A.; Chilton, Neil B.

doi:10.1128/aem.02286-13

Cited by 54 publications

(27 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…was performed by PCR. Primers targeted six Rickettsia -specific gene fragments as follows: a 434 bp fragment of the 17-kDa , 834 bp of gltA , 629 bp of ompA , 1332 bp of rrs , 920 bp of sca4 , and 865 bp of ompB , according to previous descriptions [14–17]. Sterile water was used as a negative control and the DNA of spotted fever group rickettsiae amplified in our laboratory was used as a positive control [18–20].…”

Section: Methodsmentioning

confidence: 99%

First report of Rickettsia raoultii and R. slovaca in Melophagus ovinus, the sheep ked

et al. 2016

View full text Add to dashboard Cite

Background Melophagus ovinus (Diptera: Hippoboscidae), a hematophagous ectoparasite, is mainly found in Europe, Northwestern Africa, and Asia. This wingless fly infests sheep, rabbits, and red foxes, and causes inflammation, wool loss and skin damage. Furthermore, this parasite has been shown to transmit diseases, and plays a role as a vector. Herein, we investigated the presence of various Rickettsia species in M. ovinus.MethodsIn this study, a total of 95 sheep keds were collected in Kuqa County and Alaer City southern region of Xinjiang Uygur Autonomous Region, northwestern China. First, collected sheep keds were identified on the species level using morphological keys and molecular methods based on a fragment of the 18S ribosomal DNA gene (18S rDNA). Thereafter, to assess the presence of rickettsial DNA in sheep keds, the DNA of individual samples was screened by PCR based on six Rickettsia-specific gene fragments originating from six genes: the 17-kilodalton antigen gene (17-kDa), 16S rRNA gene (rrs), surface cell antigen 4 gene (sca4), citrate synthase gene (gltA), and outer membrane protein A and B genes (ompA and ompB). The amplified products were confirmed by sequencing and BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome).ResultsAccording to its morphology and results of molecular analysis, the species was identified as Melophagus ovinus, with 100% identity to M. ovinus from St. Kilda, Australia (FN666411). DNA of Rickettsia spp. were found in 12 M. ovinus samples (12.63%, 12/95). Rickettsia raoultii and R. slovaca were confirmed based on phylogenetic analysis, although the genetic markers of these two rickettsial agents amplified in this study showed molecular diversity.ConclusionsThis is the first report of R. raoultii and R. slovaca DNA in M. ovinus. Rickettsia slovaca was found for the first time around the Taklimakan Desert located in China. This finding extends the geographical range of spotted fever group rickettsiae. Electronic supplementary materialThe online version of this article (doi:10.1186/s13071-016-1885-7) contains supplementary material, which is available to authorized users.

show abstract

Section: Methodsmentioning

confidence: 99%

First report of Rickettsia raoultii and R. slovaca in Melophagus ovinus, the sheep ked

et al. 2016

View full text Add to dashboard Cite

show abstract

“…in ticks from pet dogs, in Shihezi City, northwestern ChinaTargetGenPrimer (reference)Sequences (5′–3′)Fragment length (bp)Tick 16S rRNA T - 16S (F) T - 16S (R) (Chen et al 2014)CTGCTCAATGATTTTTTAAATTGCTGTGGCCGGTCTGAACTCAGATCAAGT460 12S rRNA 12S (F) 12S (R) (Szabó et al 2005)AAACTAGGATTAGATACCCTATTATTTTAGCTATGTAACGACTTATCTTAATAAAGAGTG400 coxI TY - J -1,449 C1 - N -2,312 (Chen et al 2014)AATTTACAGTTTATCGCCTCATACAATAAAGCCTAATA889 Rickettsi a spp. rrs R - 16S (F) R - 16S (R) (Anstead and Chilton 2013)ATCAGTACGGAATAACTTTTATGCCTCTTGCGTTAGCTCAC1284 17-kDa 17 - kDa (5F) 17 - kDa (3R) 17 - kDa (1F) 17 - kDa (2R) (Anstead and Chilton 2013)GCTTTACAAAATTCTAAAAACCATATATGTCTATCAATTCACAACTTGCCGTTGCTCTTGCAACTTCTATGTTCATTGTTCGTCAGGTTGGCG434 glt A gltA (F) gltA (R) (Anstead and Chilton 2013)ATGACCAATGAAAATAATAATATTGCAAAAAGTACAGTGAACA1078 sca 1 sca1 (F) sca1 (R) (Anstead and Chilton 2013)GGTGATGAAGAAGAGTCTCCTCTTTAAAATTATGTTCTAC657 gene D gene D (F) gene D (R)(Sekeyova et al 2001; Wei et al 2015)CGGTAACCTAGATACAAGTGATATAAGCTATTGCGTCATCTC920 ompA ompA (F) ompA (R) (Anstead and Chilton 2013)ATGGCGAATATTTCTCCAAAAAGTGCAGCATTCGCTCCCCCT530 ompB ompB (F) OmpB (R) (Anstead and Chilton 2013)TACTTCCGGTTACAGCAAAGTAAACAATAATCAAGGTACTGT812 …”

Section: Methodsmentioning

confidence: 99%

Molecular detection of spotted fever group rickettsiae in ticks parasitizing pet dogs in Shihezi City, northwestern China

et al. 2019

View full text Add to dashboard Cite

A total of 178 adult ticks were collected from 32 pet dogs from five veterinary clinics in Shihezi City, Xinjiang Uygur Autonomous Region (XUAR), northwestern China. All the ticks were identified by comprehensive morphological and genetic analyses, and rickettsiae were detected by seven Rickettsia-specific genetic markers in the ticks. The ticks collected were identified as Rhipicephalus sanguineus sensu lato. Twenty-one of the 178 samples (11.8%) were positive for rickettsiae. Among these, in 13 (61.9%) samples Candidatus R. barbariae were identified, in five (23.8%) samples R. massiliae, and in three (14.3%) samples R. conorii. This study indicates that more attention should be paid to rickettsial infection in pet dogs and their ticks, because the latter may pose an epidemiological risk for tick-borne transmission of rickettsiae to human beings.Electronic supplementary materialThe online version of this article (10.1007/s10493-018-00337-1) contains supplementary material, which is available to authorized users.

show abstract

“…Each PCR assay included a negative control (distilled water instead of tick DNA template) and a positive control (containing sequence-verified DNA from R. raoultii obtained from the tick Dermacentor nuttalli collected in XUAR) [15]. Purification and sequencing of the PCR products were performed as described above [16,17].…”

Section: Detection Of Rickettsiae Sequencing and Phylogenetic Analysesmentioning

confidence: 99%

Rickettsiae in the common pipistrelle Pipistrellus pipistrellus (Chiroptera: Vespertilionidae) and the bat soft tick Argas vespertilionis (Ixodida: Argasidae)

et al. 2020

View full text Add to dashboard Cite

Background: Increasing molecular evidence supports that bats and/or their ectoparasites may harbor vector-borne bacteria, such as bartonellae and borreliae. However, the simultaneous occurrence of rickettsiae in bats and bat ticks has been poorly studied. Methods: In this study, 54 bat carcasses and their infesting soft ticks (n = 67) were collected in Shihezi City, northwestern China. The heart, liver, spleen, lung, kidney, small intestine and large intestine of bats were dissected, followed by DNA extraction. Soft ticks were identified both morphologically and molecularly. All samples were examined for the presence of rickettsiae by amplifying four genetic markers (17-kDa, gltA, ompA and ompB). Results: All bats were identified as Pipistrellus pipistrellus, and their ticks as Argas vespertilionis. Molecular analyses showed that DNA of Rickettsia parkeri, R. lusitaniae, R. slovaca and R. raoultii was present in bat organs/tissues. In addition, nine of the 67 bat soft ticks (13.43%) were positive for R. raoultii (n = 5) and R. rickettsii (n = 4). In the phylogenetic analysis, these bat-associated rickettsiae clustered together with conspecific sequences reported from other host and tick species, confirming the above results. Conclusions: To the best of our knowledge, DNA of R. parkeri, R. slovaca and R. raoultii was detected for the first time in bat organs/tissues. This is also the first molecular evidence for the presence of R. raoultii and R. rickettsii in bat ticks. To our knowledge, R. parkeri was not known to occur in Asia. Our results highlight the need to assess rickettsial agents in a broader range of bat species and associated tick species.

show abstract

A Novel Rickettsia Species Detected in Vole Ticks (Ixodes angustus) from Western Canada

Cited by 54 publications

References 33 publications

First report of Rickettsia raoultii and R. slovaca in Melophagus ovinus, the sheep ked

First report of Rickettsia raoultii and R. slovaca in Melophagus ovinus, the sheep ked

Molecular detection of spotted fever group rickettsiae in ticks parasitizing pet dogs in Shihezi City, northwestern China

Rickettsiae in the common pipistrelle Pipistrellus pipistrellus (Chiroptera: Vespertilionidae) and the bat soft tick Argas vespertilionis (Ixodida: Argasidae)

Contact Info

Product

Resources

About