A novel recombinant of Hepatitis B
            virus genotypes G and C isolated from a Thai patient with hepatocellular carcinoma

Suwannakarn, Kamol; Tangkijvanich, Pisit; Theamboonlers, Apiradee; Abe, Kenji; Poovorawan, Yong

doi:10.1099/vir.0.81241-0

Cited by 44 publications

(44 citation statements)

References 23 publications

(22 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[20][21][22][23] . In Asia, recombination of genotype C/D has been reported from Tibet and China [21,23] , whereas recombination of B and C has been detected in Japan [24] .…”

Section: Discussionmentioning

confidence: 99%

Identification and characterization of genotype A and D recombinant hepatitis B virus from Indian chronic HBV isolates

Chauhan

Kazim²,

Kumar³

et al. 2008

WJG

View full text Add to dashboard Cite

AIM:To confirm the presence of recombination, fulllength hepatitis B virus (HBV) from chronic patients was sequenced and analyzed. METHODS: Full-length HBV genomes from 12 patients were amplified and sequenced in an automated sequencer. Phylogenetic analysis was carried out on full-length, Core and preS2/Surface regions using MEGA software. SimPlot Boot Scanning and amino acid sequence analysis were performed for confirmation of recombination. RESULTS: Eight patients were infected with genotype D strain; one patient with genotype A and three patients had genotype A and D recombination; two of them had cirrhosis and one had hepatocellular carcinoma. Phylogenetic analysis of core and preS2/surface regions separately showed evidence of genotype A and D recombination. The breakpoints of recombination were found to be at the start of preS2 and at the end

show abstract

“…[20][21][22][23] . In Asia, recombination of genotype C/D has been reported from Tibet and China [21,23] , whereas recombination of B and C has been detected in Japan [24] .…”

Section: Discussionmentioning

confidence: 99%

Identification and characterization of genotype A and D recombinant hepatitis B virus from Indian chronic HBV isolates

Chauhan

Kazim²,

Kumar³

et al. 2008

WJG

View full text Add to dashboard Cite

show abstract

“…It was noted that HBV genotyping using only a part of the viral genome may be misleading. 43 HBV/G, which often infects homosexual individuals, is also present in individuals harboring HBV/A. 6,30,34,44,45 This is partly due to the poor replicative capacity of HBV/G.…”

Section: Discussionmentioning

confidence: 99%

Identification of Novel Recombinant Forms of Hepatitis B Virus Generated from Genotypes Ae and G in HIV-1-Positive Japanese Men Who Have Sex with Men

Kojima

Kawahata

Mori

et al. 2015

AIDS Research and Human Retroviruses

View full text Add to dashboard Cite

The rare hepatitis B virus (HBV) genotype G (HBV/G) coinfects HIV-1-positive individuals along with HBV/A and generates recombinants. However, the circulation of HBV A/G recombinants remains poorly understood. This molecular epidemiologic study examined HBV A/G recombinants in Japanese HIV-1-positive men who have sex with men (MSM). Initially, blood specimens submitted for confirmatory tests of HIV infection in Osaka and Tokyo, Japan, from 2006 to 2013 were examined for HIV-1, and HIV-1-positive specimens were screened for HBV. Among

show abstract

“…In particular, Asian strains of HBV (genotypes B and C) vary genetically and can be classified into various subgroups (21). In addition to these classifications, intergenotypic recombinant of HBV has been observed in geographical regions where there are cocirculating genotypes (2,3,5,11,20,25,26). We report here the complete genomic sequence and phylogenetic analyses of an HBV strain isolated in Vietnam that has shown a high divergence from these genotypes and also a novel complex recombinant.…”

Section: Hepatitis B Virus (Hbv) Infection Is a Global Health Problemmentioning

confidence: 99%

“…More interestingly, genotype G is quite rare in Asia and undetectable in Vietnam (6,28). With the limited data available, the mechanism of this complex intergenotype is still unclear, although there is a report of HBV (DQ078791) with the C/G recombinant genotype in Thailand (26). By phylogenetic tree analysis of the complete genome, it was found that the DQ078791 isolate belongs to genotype G and not to the new genotype I (data not shown).…”

Section: Hepatitis B Virus (Hbv) Infection Is a Global Health Problemmentioning

confidence: 99%

New Complex Recombinant Genotype of Hepatitis B Virus Identified in Vietnam

Huy

Ngoc

Abe

2008

J Virol

Self Cite

221

116

View full text Add to dashboard Cite

Hepatitis B virus (HBV) infection is a global health problem.Approximately 350 million people worldwide are chronic carriers of the virus (12). Eight HBV genotypes from A to H are defined by a divergence in the entire nucleotide sequence of more than 8% (1,14,18,19,23). The prevalence and distribution of HBV genotypes vary geographically (6,8,9). Some genotypes have been split into subgroups. In particular, Asian strains of HBV (genotypes B and C) vary genetically and can be classified into various subgroups (21). In addition to these classifications, intergenotypic recombinant of HBV has been observed in geographical regions where there are cocirculating genotypes (2,3,5,11,20,25,26). We report here the complete genomic sequence and phylogenetic analyses of an HBV strain isolated in Vietnam that has shown a high divergence from these genotypes and also a novel complex recombinant.A serum sample was obtained from a 31-year-old male Vietnamese patient who lived in Hanoi, Vietnam. He was diagnosed with acute hepatitis B at Bach Mai Hospital, Hanoi, Vietnam, in 2003. This patient was seropositive for HBsAg and immunoglobulin M anti-HBc antibody with a high level of alanine transaminase (1,990 UI/liter). PCR using HBV genotype-specific primers (16) was used to amplify the virus genotype. The full-length 3.2 kb was amplified by using single-round amplification of the full HBV genome, using the primer pair HBV4 5Ј-CCGGAAAGCTTATGCTCTTCTTTTTCACCTC TGCCTAATCATC-3Ј (sense; underlining of the primer sequence indicates the HindIII site) and HBV4R 5Ј-CCGGAG AGCTCATGCTCTTCAAAAAGTTGCATGGTGCTGGT G-3Ј (antisense; underlining of the primer sequence indicates the SacI site) (4). PCR and sequencing analyses were done as described previously (17). Briefly, viral DNA was extracted from 100 l of serum by using a DNA/RNA extraction kit (SepaGene RV-R; Sanko Junyaku Co., Ltd., Tokyo, Japan).The resulting pellet was resuspended in 50 l of RNase-free water and kept at Ϫ20°C until use. The PCR conditions consisted of preincubation at 94°C and a 2-min activation of Blend Taq-Plus DNA polymerase (Toyobo, Ltd., Tokyo, Japan), followed by 40 cycles of PCR (94°C for 15 s, 55°C for 45 s, and 72°C for 3 min 20 s), with a final extension for 7 min at 72°C. The PCR products were separated by 1% agarose gel electrophoresis and purified by using a QIAquick gel extraction kit (Qiagen, Inc., Chatsworth, CA). Purified DNA was subjected to direct sequencing using an ABI Prism BigDye terminator cycle sequencing ready reaction kit and automated an ABI 3130 DNA sequencer (Applied Biosystems, Foster City, CA). Evolutionary and phylogenetic tree analysis were performed by using MEGA software version 3.0 (10), using the neighborjoining method, with 1,000 bootstrapped data sets. Genetic distance calculation and pairwise distance comparisons used the Kimura two-parameter model integrated into the MEGA software. Intergenotype recombination of HBV strains was investigated by using the SIMPLOT program version 3.5 (http: //sray.med.som.jhmi.edu/SCRoftware/simplot/ [...

show abstract

A novel recombinant of Hepatitis B virus genotypes G and C isolated from a Thai patient with hepatocellular carcinoma

Cited by 44 publications

References 23 publications

Identification and characterization of genotype A and D recombinant hepatitis B virus from Indian chronic HBV isolates

Identification and characterization of genotype A and D recombinant hepatitis B virus from Indian chronic HBV isolates

Identification of Novel Recombinant Forms of Hepatitis B Virus Generated from Genotypes Ae and G in HIV-1-Positive Japanese Men Who Have Sex with Men

New Complex Recombinant Genotype of Hepatitis B Virus Identified in Vietnam

Contact Info

Product

Resources

About