A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

Abstract

Multiplex oligonucleotide ligation-PCR (MOL-PCR) is a rapid method for simultaneous detection of multiple molecular markers within a single reaction. MOL-PCR is increasingly employed in microbial detection assays, where its ability to facilitate identification and further characterization via simple analysis is of great benefit and significantly simplifies routine diagnostics. When adapted to microsphere suspension arrays on a MAGPIX reader, MOL-PCR has the potential to outperform standard nucleic acid-based diagnostic assays. This study represents the guideline towards in-house MOL-PCR assay optimization using the example of foodborne pathogens (bacteria and parasites) with an emphasis on the appropriate choice of crucial parameters. The optimized protocol focused on specific sequence detection utilizes the fluorescent reporter BODIPY-TMRX and self-coupled magnetic microspheres and allows for a smooth and brisk workflow which should serve as a guide for the development of MOL-PCR assays intended for pathogen detection.

Development and Inter-Laboratory Validation of Diagnostics Panel for Detection of Biothreat Bacteria Based on MOL-PCR Assay

“…The final size of the ligation product ranged from 102 to 113 base pairs. All other parameters for MOLigo probe design were used according to the previous study [25]. Forward primer [43] CGCGGTAGTAAGAAGTGAGA…”

“…The last step is the hybridization of the PCR product using a specific 24 base DNA sequence, which is already part of the probe and its complementary sequence located on the selected set of magnetic microspheres. Precise optimization of the MOL-PCR assay is crucial and key points in the optimization process were experimentally identified [25]. Since that time, MOL-PCR has been successfully adopted for parallel detection of many human, animal, or even insect pathogens [25][26][27][28][29][30][31].…”

“…Precise optimization of the MOL-PCR assay is crucial and key points in the optimization process were experimentally identified [25]. Since that time, MOL-PCR has been successfully adopted for parallel detection of many human, animal, or even insect pathogens [25][26][27][28][29][30][31]. All proposed detection panels show high specificity and sensitivity and are useful for screening a wide spectrum of samples in general.…”

“…To address the need of security bodies to be capable of simultaneously detecting the four major biothreat bacteria (B. anthracis, Brucella spp., Y. pestis and F. tularensis), a comprehensive and specific protocol for the MOL-PCR suspension array was developed in this study. The scheme of the whole MOL-PCR reaction is figuratively described in the our previous study [25]. The main aim of the study was to construct a panel of detection markers for all listed pathogens using at least two DNA markers (chromosomal markers and virulence genes for each pathogen).…”

Development of a Multiplex PCR and Magnetic DNA Capture Assay for Detecting Six Species Pathogens of the Genera Anaplasma and Ehrlichia in Canine, Bovine, Caprine and Ovine Blood Samples from Grenada, West Indies

“…The assay involves in vitro amplification of a 100 bp 16S rDNA gene fragment targeting six different species of Anaplasma and Ehrlichia and is followed by the capture and detection of species-specific amplicons using pathogen-specific complementary oligonucleotide probes attached to magnetic beads. The xMAP hybridization assay offers a distinct advantage similar to several previously reported similar methods for detecting human and veterinary pathogens [56][57][58][59].…”