A Novel NF-κB-Regulated Site within the Human Iγ1 Promoter Requires p300 for Optimal Transcriptional Activity

Abstract

Transcriptional activation of germline (GL) promoters occurs through binding of NF-κB to three evolutionarily conserved sites within a CD40 response region in the human and mouse GL Iγ and Iε promoters. Here we identify and characterize a novel NF-κB binding site (κB6) within the human GL Iγ1 promoter that plays an essential role in basal- and CD40-induced transcription. This site is adjacent to identified CREB/activating transcription factor (ATF) sites, present in the Iγ1 but not the Iγ3 promoter, which are important for the amplification of transcription. Our data suggest a cohesive protein complex regulating Iγ1 promoter activity because disruption of any individual NF-κB or CREB/ATF site markedly lowers the overall inducible activity of the promoter. In addition, alteration of helical phasing within the promoter indicates spatial orientation of CREB/ATF and NF-κB, proteins contributes directly to promoter activity. We found that CREB and p50 transactivators, as well as coactivator p300, interact in vivo with the Iγ1 promoter in the presence and absence of CD40 signaling in Ramos and primary B cells. However, the level of CREB and p300 binding differs as a consequence of activation in primary B cells. Furthermore, overexpression of p300, and not a mutant lacking acetyltransferase activity, significantly increases Iγ1 construct-specific transcription. Together these data support a model whereby CREB and multiple NF-κB complexes bind to the Iγ1 promoter and recruit p300. CD40 signals induce p300-dependent changes that result in optimal Iγ1 promoter activity.

Single Nucleotide Changes in the Human Iγ1 and Ιγ4 Promoters Underlie Different Transcriptional Responses to CD40

“…CD19 + /IgG - B cells were isolated from total mononuclear cells (PBMCs) as previously described (30). …”

“…Preparation of nuclear extracts and electromobility shift assays (EMSA) were performed as previously detailed (30). The following double stranded oligos containing wildtype and mutated sequences (base changes are denoted in bold capital letters) were used as probes: γ4-36bp wt: 5′gaagacaaatagcggctgacggcgggggcggggccgcccacat3′; γ4-mutCREB(A): 5′gaagacaaatagcggctgacggc A ggggcggggccgcccaat 3′; γ4-mutκB6: 5′gaagacaaatagcggctgacggcgggggcggggc T gcccacat 3′; γ1-36bp wt: 5′aaatatcggctgacggcaggggcggggctgcccaca 3′; γ1-CD40RR: 5′gtggactccccctcgccctctgacccagaaaccaccagaagaaaagggaacttcaggaagtaagtggtgccgcc 3′; γ4-CD40RR: 5′gtggactccccctcgccctctgacacagaaaccaccagaagaaaagggaacttcaggaagtaaggg gtgccgct 3′ and double-stranded competitor NF-κB consensus oligo (Promega): 5′agttgaggggactttcccaggc 3′.…”

“…Further support for this comes from our own work on the human Iγ1 promoter where we identified a 36 bp region downstream of the Iγ1 start site that enhances GLT and contains binding motifs for CREB/ATF-1/ATF-2 and NF-κB. Sequence differences in the Iγ3 36 bp element accounted for weaker GLT upon CD154 activation in an in vitro system (29) and p300 activity associated with the 36 bp element was found to be required for optimal Iγ1 transcription (30). The entire proximal promoter region including the 36 bp element is highly conserved between the Iγ promoters, which is unexpected given the unique in vivo expression pattern in response to CD40 signals observed for the individual promoters (31-35).…”

Use of chromatin immunoprecipitation (chip) to detect transcription factor binding to highly homologous promoters in chromatin isolated from unstimulated and activated primary human B cells

“…Our laboratory’s focus has been to understand the basis for Iγ promoter activity in response to signals through the CD40 pathway ( 12 - 14 ). This pathway is triggered by cognate interactions with CD40 ligand (CD40L or CD154) expressed on activated CD4 + T cells and has been shown to be highly dependent on NF-κB ( 15 - 17 ).…”

c-Rel plays a key role in deficient activation of B cells from a non–X-linked hyper-IgM patient

“…39 The following end-labeled probes for the CD23a and CD23b promoters were used in EMSAs: CD23b-I, 5Ј-CGACCCTTAGCTACTGCCTTTCAC-CCAGAAGA-3Ј; CD23b-II, 5Ј-CGAAGCGGGGCTCCCCAGTCCC-TCTCTGGGAAAGAGGGTGA-3Ј; CD23b-III, 5Ј-CGATTTCTAAGAA-AGGGACTGGTGTGAGTAAGGAGGTGAGGC-3Ј; and CD23a-NF-B, For personal use only. on March 28, 2019. by guest www.bloodjournal.org From 5Ј-AATAATAACACGGACTTCACCGGGTGTGGGGAGCA-3Ј.…”